rem
stringlengths
1
226k
add
stringlengths
0
227k
context
stringlengths
6
326k
meta
stringlengths
143
403
input_ids
listlengths
256
256
attention_mask
listlengths
256
256
labels
listlengths
128
128
for (int i = 0; i < references.length; i++)
for (int i = 0; i < references.length; i++) {
private void doOpenWithReferences(IProject project, IProgressMonitor monitor) throws CoreException { if (!project.exists() || project.isOpen()) return; project.open(new SubProgressMonitor(monitor, 1000)); IProject[] references = project.getReferencedProjects(); for (int i = 0; i < references.length; i++) doOpenWithReferences(references[i], monitor); }
55805 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/55805/e38d295ea613cf9f08aadb93a84a33d2e91abc5f/OpenResourceAction.java/clean/bundles/org.eclipse.ui.ide/extensions/org/eclipse/ui/actions/OpenResourceAction.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 1875, 202, 1152, 918, 741, 3678, 1190, 8221, 12, 45, 4109, 1984, 16, 6862, 202, 45, 5491, 7187, 6438, 13, 1216, 30015, 288, 9506, 202, 430, 16051, 4406, 18, 1808, 1435, 747, 1984, 18, 291, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 1875, 202, 1152, 918, 741, 3678, 1190, 8221, 12, 45, 4109, 1984, 16, 6862, 202, 45, 5491, 7187, 6438, 13, 1216, 30015, 288, 9506, 202, 430, 16051, 4406, 18, 1808, 1435, 747, 1984, 18, 291, 3...
public void start() throws FetchException {
public synchronized void start() throws FetchException {
public void start() throws FetchException { try { currentState = SingleFileFetcher.create(this, this, new ClientMetadata(), uri, ctx, actx, ctx.maxNonSplitfileRetries, 0, false, null, true, returnBucket); if(currentState != null) currentState.schedule(); } catch (MalformedURLException e) { throw new FetchException(FetchException.INVALID_URI, e); } }
50619 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/50619/a6a9cc01004d94d4bdefc0b76c0bdb1962187369/ClientGetter.java/clean/src/freenet/client/async/ClientGetter.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 787, 1435, 1216, 8065, 503, 288, 202, 202, 698, 288, 1082, 202, 2972, 1119, 273, 10326, 812, 16855, 18, 2640, 12, 2211, 16, 333, 16, 394, 2445, 2277, 9334, 6862, 202, 165...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 787, 1435, 1216, 8065, 503, 288, 202, 202, 698, 288, 1082, 202, 2972, 1119, 273, 10326, 812, 16855, 18, 2640, 12, 2211, 16, 333, 16, 394, 2445, 2277, 9334, 6862, 202, 165...
slaveServer = new SlaveServer("http:
public void clear() { setID(-1L); databases = new ArrayList(); steps = new ArrayList(); hops = new ArrayList(); notes = new ArrayList(); dependencies = new ArrayList(); partitionSchemas = new ArrayList(); name = null; filename = null; readStep = null; writeStep = null; inputStep = null; outputStep = null; updateStep = null; logTable = null; logConnection = null; sizeRowset = Const.ROWS_IN_ROWSET; sleepTimeEmpty = Const.SLEEP_EMPTY_NANOS; sleepTimeFull = Const.SLEEP_FULL_NANOS; maxDateConnection = null; maxDateTable = null; maxDateField = null; maxDateOffset = 0.0; maxDateDifference = 0.0; undo = new ArrayList(); max_undo = Const.MAX_UNDO; undo_position = -1; counters = new Hashtable(); resultRows = null; clearUndo(); clearChanged(); useBatchId = true; // Make this one the default from now on... logfieldUsed = false; // Don't use the log-field by default... modifiedUser = "-"; //$NON-NLS-1$ modifiedDate = new Value("modified_date", new Date()); //$NON-NLS-1$ // LOAD THE DATABASE CACHE! dbCache = DBCache.getInstance(); directoryTree = new RepositoryDirectory(); // Default directory: root directory = directoryTree; resultRows = new ArrayList(); resultFiles = new ArrayList(); feedbackShown = true; feedbackSize = Const.ROWS_UPDATE; // setInternalKettleVariables(); Don't clear the internal variables for ad-hoc transformations, it's ruines the previews }
9547 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/9547/7990f71cb7a895462621752012cc61e327c00fba/TransMeta.java/clean/src/be/ibridge/kettle/trans/TransMeta.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 11735, 2081, 273, 394, 9708, 836, 2081, 2932, 2505, 30, 11735, 2081, 273, 394, 9708, 836, 2081, 2932, 2505, 30, 11735, 2081, 273, 394, 9708, 836, 2081, 2932, 2505, 30, 11735, 2081, 273, 394, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 11735, 2081, 273, 394, 9708, 836, 2081, 2932, 2505, 30, 11735, 2081, 273, 394, 9708, 836, 2081, 2932, 2505, 30, 11735, 2081, 273, 394, 9708, 836, 2081, 2932, 2505, 30, 11735, 2081, 273, 394, 9...
tag.put("checked", "checked");
if (uuid.equals(input[i])) { tag.put("checked", "checked"); }
protected void onComponentTag(final ComponentTag tag) { // Default handling for component tag super.onComponentTag(tag); // must be attached to <input type="checkbox" .../> tag checkComponentTag(tag, "input"); checkComponentTagAttribute(tag, "type", "checkbox"); CheckGroup group = (CheckGroup)findParent(CheckGroup.class); String path = getPath(); if (group == null) { throw new WicketRuntimeException( "Check component [" + path + "] cannot find its parent CheckGroup. All Check components must be a child of or below in the hierarchy of a CheckGroup component."); } String relativePath = path.substring(group.getPath().length() + 1); // assign name and value tag.put("name", group.getInputName()); tag.put("value", relativePath); // check if the model collection of the group contains the model object. // if it does check the check box. Collection collection = (Collection)group.getModelObject(); // check for npe in group's model object if (collection == null) { throw new WicketRuntimeException( "CheckGroup [" + group.getPath() + "] contains a null model object, must be an object of type java.util.Collection"); } if (group.hasRawInput()) { String rawInput = group.getRawInput(); if (rawInput != null && rawInput.indexOf(relativePath) != -1) { tag.put("checked", "checked"); } } else if (collection.contains(getModelObject())) { tag.put("checked", "checked"); } if (group.wantOnSelectionChangedNotifications()) { // url that points to this components IOnChangeListener method final CharSequence url = group.urlFor(IOnChangeListener.INTERFACE); Form form = (Form)group.findParent(Form.class); if (form != null) { tag.put("onclick", form.getJsForInterfaceUrl(url)); } else { // NOTE: do not encode the url as that would give invalid // JavaScript tag.put("onclick", "window.location.href='" + url + "&" + group.getInputName() + "=' + this.value;"); } } if (!isActionAuthorized(ENABLE) || !isEnabled() || !group.isEnabled()) { tag.put(ATTR_DISABLED, ATTR_DISABLED); } }
46434 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/46434/e3fa48d0793cd702937bc7ddf5cfc1267fc9de59/Check.java/clean/wicket/src/main/java/wicket/markup/html/form/Check.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 918, 603, 1841, 1805, 12, 6385, 5435, 1805, 1047, 13, 202, 95, 202, 202, 759, 2989, 5057, 364, 1794, 1047, 202, 202, 9565, 18, 265, 1841, 1805, 12, 2692, 1769, 202, 202, 759,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 918, 603, 1841, 1805, 12, 6385, 5435, 1805, 1047, 13, 202, 95, 202, 202, 759, 2989, 5057, 364, 1794, 1047, 202, 202, 9565, 18, 265, 1841, 1805, 12, 2692, 1769, 202, 202, 759,...
/* else if(bmsg.getWhat() == BufferUpdate.SAVED) { maybeReloadDirectory(MiscUtilities.getParentOfPath( bmsg.getBuffer().getPath())); } */
public void handleMessage(EBMessage msg) { if(msg instanceof PropertiesChanged) propertiesChanged(); else if(msg instanceof BufferUpdate) { BufferUpdate bmsg = (BufferUpdate)msg; if(bmsg.getWhat() == BufferUpdate.CREATED || bmsg.getWhat() == BufferUpdate.CLOSED) browserView.updateFileView(); // hacked BufferIORequest to send VFSUpdates in case // two stage save is off now... /* else if(bmsg.getWhat() == BufferUpdate.SAVED) { maybeReloadDirectory(MiscUtilities.getParentOfPath( bmsg.getBuffer().getPath())); } */ } else if(msg instanceof PluginUpdate) { PluginUpdate pmsg = (PluginUpdate)msg; if(pmsg.getWhat() == PluginUpdate.LOADED || pmsg.getWhat() == PluginUpdate.UNLOADED) { plugins.updatePopupMenu(); } } else if(msg instanceof VFSUpdate) { maybeReloadDirectory(((VFSUpdate)msg).getPath()); } } //}}}
8690 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/8690/f01bed666b849058464ee055f4009058c66ec946/VFSBrowser.java/buggy/org/gjt/sp/jedit/browser/VFSBrowser.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 1640, 1079, 12, 29258, 1079, 1234, 13, 202, 95, 202, 202, 430, 12, 3576, 1276, 6183, 5033, 13, 1082, 202, 4738, 5033, 5621, 202, 202, 12107, 309, 12, 3576, 1276, 3525, 18...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 1640, 1079, 12, 29258, 1079, 1234, 13, 202, 95, 202, 202, 430, 12, 3576, 1276, 6183, 5033, 13, 1082, 202, 4738, 5033, 5621, 202, 202, 12107, 309, 12, 3576, 1276, 3525, 18...
public static void generateGlueCodeForJNIMethod(VM_Assembler asm, VM_Method mth) { int offset; asm.emitSTAddrU(FP,-JNI_GLUE_FRAME_SIZE,FP); // buy the glue frame // we may need to save CR in the previous frame also if CR will be used // CR is to be saved at FP+4 in the previous frame // Here we check if this is a JNI function that takes the vararg in the ... style // This includes CallStatic<type>Method, Call<type>Method, CallNonVirtual<type>Method // For these calls, the vararg starts at the 4th or 5th argument (GPR 6 or 7) // So, we save the GPR 6-10 and FPR 1-3 in a volatile register save area // in the glue stack frame so that the JNI function can later repackage the arguments // based on the parameter types of target method to be invoked. // (For long argument lists, the additional arguments, have been saved in // the spill area of the OS caller, and will be retrieved from there.) // // If we are compiling such a JNI Function, then emit the code to store // GPR 4-10 and FPR 1-6 into the volatile save area. String mthName = mth.getName().toString(); if ((mthName.startsWith("Call") && mthName.endsWith("Method")) || mthName.equals("NewObject")) { //-#if RVM_WITH_POWEROPEN_ABI offset = STACKFRAME_HEADER_SIZE + 3*BYTES_IN_STACKSLOT; // skip over slots for GPR 3-5 for (int i = 6; i <= 10; i++ ) { asm.emitSTAddr(i, offset, FP); offset+=BYTES_IN_ADDRESS; } // store FPRs 1-3 in first 3 slots of volatile FPR save area for (int i = 1; i <= 3; i++) { asm.emitSTFD (i, offset, FP); offset+=BYTES_IN_DOUBLE; } //-#elif RVM_WITH_SVR4_ABI || RVM_WITH_MACH_O_ABI // save all parameter registers offset = STACKFRAME_HEADER_SIZE + 0; for (int i=FIRST_OS_PARAMETER_GPR; i<=LAST_OS_PARAMETER_GPR; i++) { asm.emitSTAddr(i, offset, FP); offset += BYTES_IN_ADDRESS; } for (int i =FIRST_OS_PARAMETER_FPR; i<=LAST_OS_PARAMETER_FPR; i++) { asm.emitSTFD(i, offset, FP); offset += BYTES_IN_DOUBLE; } //-#endif } else { //-#if RVM_WITH_SVR4_ABI || RVM_WITH_MACH_O_ABI // adjust register contents (following SVR4 ABI) for normal JNI functions // especially dealing with long, spills // number of parameters of normal JNI functions should fix in // r3 - r12, f1 - f15, + 24 words, convertParametersFromSVR4ToJava(asm, mth); //-#endif } // Save AIX non-volatile GPRs that will not be saved and restored by RVM. // offset = STACKFRAME_HEADER_SIZE + JNI_GLUE_SAVED_VOL_SIZE; // skip 20 word volatile reg save area for (int i = FIRST_RVM_RESERVED_NV_GPR; i <=LAST_RVM_RESERVED_NV_GPR; i++) { asm.emitSTAddr(i, offset, FP); offset += BYTES_IN_ADDRESS; } // set the method ID for the glue frame // and save the return address in the previous frame // asm.emitLVAL(S0, INVISIBLE_METHOD_ID); asm.emitMFLR(REGISTER_ZERO); asm.emitSTW (S0, STACKFRAME_METHOD_ID_OFFSET, FP); asm.emitSTAddr(REGISTER_ZERO, JNI_GLUE_FRAME_SIZE + STACKFRAME_NEXT_INSTRUCTION_OFFSET, FP); // Attempt to change the vpStatus of the current Processor to IN_JAVA // // on entry T0 = JNIEnv* which is an interior pointer to this thread's VM_JNIEnvironment. // We first adjust this in place to be a pointer to a VM_JNIEnvironment and then use // it to acquire PROCESSOR_REGISTER (and JTOC on OSX/Linux). // // AIX non volatile gprs 13-16 have been saved & are available (also gprs 11-13 can be used). // S0=13, S1=14, TI=15, PROCESSOR_REGISTER=16 are available (&have labels) for changing state. // we leave the passed arguments untouched, unless we are blocked and have to call sysVirtualProcessorYield // Map from JNIEnv* to VM_JNIEnvironment. // Must do this outside the loop as we need to do it exactly once. asm.emitADDI (T0, -VM_Entrypoints.JNIExternalFunctionsField.getOffset(), T0); int retryLoop = asm.getMachineCodeIndex(); // acquire Jikes RVM PROCESSOR_REGISTER (and JTOC OSX/Linux only). asm.emitLAddr(PROCESSOR_REGISTER, VM_Entrypoints.JNIEnvSavedPRField.getOffset(), T0); //-#if RVM_WITH_SVR4_ABI || RVM_WITH_MACH_O_ABI // on AIX JTOC is part of AIX Linkage triplet and this already set by our caller. // Thus, we only need this load on non-AIX platforms asm.emitLAddr(JTOC, VM_Entrypoints.JNIEnvSavedJTOCField.getOffset(), T0); //-#endif asm.emitLVAL (S1, VM_Entrypoints.vpStatusField.getOffset()); asm.emitLWARX (S0, S1, PROCESSOR_REGISTER); // get status for processor asm.emitCMPI (S0, VM_Processor.BLOCKED_IN_NATIVE); // check if GC in progress, blocked in native mode VM_ForwardReference frBlocked = asm.emitForwardBC(EQ); asm.emitLVAL (S0, VM_Processor.IN_JAVA); // S0 <- new state value asm.emitSTWCXr(S0, S1, PROCESSOR_REGISTER); // attempt to change state to IN_JAVA asm.emitBC (NE, retryLoop); // br if failure -retry lwarx by jumping to label0 VM_ForwardReference frInJava = asm.emitForwardB(); // branch around code to call sysYield // branch to here if blocked in native, call sysVirtualProcessorYield (pthread yield) // must save volatile gprs & fprs before the call and restore after // frBlocked.resolve(asm); offset = STACKFRAME_HEADER_SIZE; // save volatile GPRS 3-10 for (int i = FIRST_OS_PARAMETER_GPR; i <= LAST_OS_PARAMETER_GPR; i++) { asm.emitSTAddr(i, offset, FP); offset+=BYTES_IN_ADDRESS; } // save volatile FPRS 1-6 for (int i = FIRST_OS_PARAMETER_FPR; i <= LAST_OS_VARARG_PARAMETER_FPR; i++) { asm.emitSTFD (i, offset, FP); offset+=BYTES_IN_DOUBLE; } asm.emitLAddr(S1, VM_Entrypoints.the_boot_recordField.getOffset(), JTOC); // get boot record address asm.emitMR (PROCESSOR_REGISTER, JTOC); // save JTOC so we can restore below asm.emitLAddr(JTOC, VM_Entrypoints.sysTOCField.getOffset(), S1); // load TOC for syscalls from bootrecord asm.emitLAddr(KLUDGE_TI_REG, VM_Entrypoints.sysVirtualProcessorYieldIPField.getOffset(), S1); // load addr of function asm.emitMTLR (KLUDGE_TI_REG); asm.emitBCLRL(); // call sysVirtualProcessorYield in sys.C asm.emitMR (JTOC, PROCESSOR_REGISTER); // restore JTOC // restore the saved volatile GPRs 3-10 and FPRs 1-6 offset = STACKFRAME_HEADER_SIZE; // restore volatile GPRS 3-10 for (int i = FIRST_OS_PARAMETER_GPR; i <= LAST_OS_PARAMETER_GPR; i++) { asm.emitLAddr (i, offset, FP); offset+=BYTES_IN_ADDRESS; } // restore volatile FPRS 1-6 for (int i = FIRST_OS_PARAMETER_FPR; i <= LAST_OS_VARARG_PARAMETER_FPR; i++) { asm.emitLFD (i, offset, FP); offset+=BYTES_IN_DOUBLE; } asm.emitB (retryLoop); // br back to label0 to try lwarx again // NOW_IN_JAVA: // JTOC, and PR are all as Jikes RVM expects them; // params are where the Jikes RVM calling conventions expects them. // frInJava.resolve(asm); // get pointer to top java frame from JNIEnv, compute offset from current // frame pointer (offset to avoid more interior pointers) and save offset // in this glue frame // asm.emitLAddr (S0, VM_Entrypoints.JNITopJavaFPField.getOffset(), T0); // get addr of top java frame from JNIEnv asm.emitSUBFC (S0, FP, S0); // S0 <- offset from current FP // AIX -4, LINUX - 8 asm.emitSTW(S0, JNI_GLUE_FRAME_SIZE + JNI_GLUE_OFFSET_TO_PREV_JFRAME, FP); // store offset at end of glue frame // BRANCH TO THE PROLOG FOR THE JNI FUNCTION VM_ForwardReference frNormalPrologue = asm.emitForwardBL(); // relative branch and link past the following epilog, to the normal prolog of the method // the normal epilog of the method will return to the epilog here to pop the glue stack frame // RETURN TO HERE FROM EPILOG OF JNI FUNCTION // CAUTION: START OF EPILOG OF GLUE CODE // The section of code from here to "END OF EPILOG OF GLUE CODE" is nestled between // the glue code prolog and the real body of the JNI method. // T0 & T1 (R3 & R4) or F1 contain the return value from the function - DO NOT USE // assume: JTOC and PROCESSOR_REG are valid, and all RVM non-volatile // GPRs and FPRs have been restored. Our processor state will be IN_JAVA. // establish T2 -> current thread's VM_JNIEnvironment, from activeThread field // of current processor asm.emitLAddr(T2, VM_Entrypoints.activeThreadField.getOffset(), PROCESSOR_REGISTER); // T2 <- activeThread of PR asm.emitLAddr(T2, VM_Entrypoints.jniEnvField.getOffset(), T2); // T2 <- JNIEnvironment // before returning to C, set pointer to top java frame in JNIEnv, using offset // saved in this glue frame during transition from C to Java. GC will use this saved // frame pointer if it is necessary to do GC with a processors active thread // stuck (and blocked) in native C, ie. GC starts scanning the threads stack at that frame. // AIX -4, LINUX -8 asm.emitLInt (T3, JNI_GLUE_FRAME_SIZE + JNI_GLUE_OFFSET_TO_PREV_JFRAME, FP); // load offset from FP to top java frame asm.emitADD (T3, FP, T3); // T3 <- address of top java frame asm.emitSTAddr(T3, VM_Entrypoints.JNITopJavaFPField.getOffset(), T2); // store TopJavaFP back into JNIEnv // check to see if this frame address is the sentinel since there // may be no further Java frame below asm.emitCMPAddrI(T3, VM_Constants.STACKFRAME_SENTINEL_FP.toInt()); VM_ForwardReference fr4 = asm.emitForwardBC(EQ); asm.emitLAddr(S0, 0, T3); // get fp for caller of prev J to C transition frame fr4.resolve(asm); // store current PR into VM_JNIEnvironment; we may have switched PRs while in Java mode. asm.emitSTAddr(PROCESSOR_REGISTER, VM_Entrypoints.JNIEnvSavedPRField.getOffset(), T2); // change the state of the VP to IN_NATIVE. // asm.emitLVAL (S0, VM_Processor.IN_NATIVE); asm.emitSTW (S0, VM_Entrypoints.vpStatusField.getOffset(), PROCESSOR_REGISTER); // Restore those AIX nonvolatile registers saved in the prolog above // Here we only save & restore ONLY those registers not restored by RVM // offset = STACKFRAME_HEADER_SIZE + JNI_GLUE_SAVED_VOL_SIZE; // skip 20 word volatile reg save area for (int i = FIRST_RVM_RESERVED_NV_GPR; i <=LAST_RVM_RESERVED_NV_GPR; i++) { asm.emitLAddr (i, offset, FP); // 4 instructions offset += BYTES_IN_ADDRESS; } // pop frame asm.emitADDI(FP, JNI_GLUE_FRAME_SIZE, FP); // load return address & return to caller // T0 & T1 (or F1) should still contain the return value // asm.emitLAddr(T2, STACKFRAME_NEXT_INSTRUCTION_OFFSET, FP); asm.emitMTLR(T2); asm.emitBCLR (); // branch always, through link register // END OF EPILOG OF GLUE CODE; rest of method generated by VM_Compiler from bytecodes of method in VM_JNIFunctions frNormalPrologue.resolve(asm); }
5245 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/5245/b910a39ad6845b8a14a18f9fcf248a47452b8dc8/VM_JNICompiler.java/buggy/rvm/src/vm/arch/powerPC/jni/VM_JNICompiler.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 760, 918, 2103, 21308, 344, 1085, 1290, 46, 50, 45, 1305, 12, 7397, 67, 1463, 5747, 749, 20415, 16, 8251, 67, 1305, 312, 451, 13, 288, 565, 509, 1384, 31, 565, 20415, 18, 18356, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 760, 918, 2103, 21308, 344, 1085, 1290, 46, 50, 45, 1305, 12, 7397, 67, 1463, 5747, 749, 20415, 16, 8251, 67, 1305, 312, 451, 13, 288, 565, 509, 1384, 31, 565, 20415, 18, 18356, ...
return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_STRING_LITERAL, null, null, null, null, null, t.getImage(), null );
return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_STRING_LITERAL, null, null, null, null, t.getImage(), null );
protected IASTExpression primaryExpression( IASTScope scope ) throws Backtrack { IToken t = null; switch (LT(1)) { // TO DO: we need more literals... case IToken.tINTEGER : t = consume(); try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_INTEGER_LITERAL, null, null, null, null, null, t.getImage(), null); } catch (ASTSemanticException e1) { failParse(); throw backtrack; } case IToken.tFLOATINGPT : t = consume(); try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_FLOAT_LITERAL, null, null, null, null, null, t.getImage(), null); } catch (ASTSemanticException e2) { failParse(); throw backtrack; } case IToken.tSTRING : case IToken.tLSTRING : t = consume(); try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_STRING_LITERAL, null, null, null, null, null, t.getImage(), null ); } catch (ASTSemanticException e5) { failParse(); throw backtrack; } case IToken.t_false : case IToken.t_true : t = consume(); try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_BOOLEAN_LITERAL, null, null, null, null, null, t.getImage(), null); } catch (ASTSemanticException e3) { failParse(); throw backtrack; } case IToken.tCHAR : case IToken.tLCHAR : t = consume(); try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_CHAR_LITERAL, null, null, null, null, null, t.getImage(), null); } catch (ASTSemanticException e4) { failParse(); throw backtrack; } case IToken.t_this : consume(IToken.t_this); try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_THIS, null, null, null, null, null, "", null); } catch (ASTSemanticException e7) { failParse(); throw backtrack; } case IToken.tLPAREN : consume(); IASTExpression lhs = expression(scope); consume(IToken.tRPAREN); try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_BRACKETED_EXPRESSION, lhs, null, null, null, null, "", null); } catch (ASTSemanticException e6) { failParse(); throw backtrack; } case IToken.tIDENTIFIER : ITokenDuple duple = name(); //TODO should be an ID Expression really try { return astFactory.createExpression( scope, IASTExpression.Kind.ID_EXPRESSION, null, null, null, null, duple, "", null); } catch (ASTSemanticException e8) { failParse(); throw backtrack; } default : try { return astFactory.createExpression( scope, IASTExpression.Kind.PRIMARY_EMPTY, null, null, null, null, null, "", null); } catch (ASTSemanticException e) { failParse(); throw backtrack; } } }
54911 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/54911/1c6c93560ac2cfe6f78ff5b297c43b796774d32c/Parser.java/clean/core/org.eclipse.cdt.core/parser/org/eclipse/cdt/internal/core/parser/Parser.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 467, 9053, 2300, 3354, 2300, 12, 467, 9053, 3876, 2146, 262, 3639, 1216, 4297, 4101, 565, 288, 3639, 467, 1345, 268, 273, 446, 31, 3639, 1620, 261, 12050, 12, 21, 3719, 3639, 288, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 467, 9053, 2300, 3354, 2300, 12, 467, 9053, 3876, 2146, 262, 3639, 1216, 4297, 4101, 565, 288, 3639, 467, 1345, 268, 273, 446, 31, 3639, 1620, 261, 12050, 12, 21, 3719, 3639, 288, ...
if (OpenCms.getLog(this).isInfoEnabled()) { OpenCms.getLog(this).info(e);
if (OpenCms.getLog(this).isErrorEnabled()) { OpenCms.getLog(this).error(e);
public String getDialogUri(String resource, CmsJspActionElement jsp) { try { CmsResource res = jsp.getCmsObject().readResource(resource, CmsResourceFilter.ALL); if (res.getTypeId() == CmsResourceTypeXmlPage.C_RESOURCE_TYPE_ID) { if (C_TEMPLATE_ONE.equals(jsp.property("template", resource))) { // display special property dialog for xmlpage types with "template one" as template return C_MODULE_PATH + "dialogs/property.jsp"; } return C_PATH_WORKPLACE + "editors/dialogs/property.jsp"; } if (res.isFolder()) { if (!res.getRootPath().startsWith(I_CmsConstants.VFS_FOLDER_SYSTEM)) { // display special property dialog for folders. excluse system folders return C_MODULE_PATH + "dialogs/property.jsp"; } return C_PATH_WORKPLACE + "editors/dialogs/property.jsp"; } String resTypeName = OpenCms.getResourceManager().getResourceType(res.getTypeId()).getTypeName(); CmsExplorerTypeSettings settings = OpenCms.getWorkplaceManager().getExplorerTypeSetting(resTypeName); if (settings.isPropertiesEnabled()) { // special properties for this type enabled, display customized dialog return URI_PROPERTY_CUSTOM_DIALOG; } } catch (CmsException e) { // should usually never happen if (OpenCms.getLog(this).isInfoEnabled()) { OpenCms.getLog(this).info(e); } } return URI_PROPERTY_DIALOG; }
51784 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/51784/fe7a7853a2990ea8bcd0a22e1f82dccdacc86150/CmsPropertyTemplateOne.java/clean/src-modules/org/opencms/frontend/templateone/CmsPropertyTemplateOne.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 514, 31774, 3006, 12, 780, 1058, 16, 31108, 1803, 1046, 22535, 13, 288, 3639, 775, 288, 5411, 7630, 400, 273, 22535, 18, 588, 4747, 921, 7675, 896, 1420, 12, 3146, 16, 21082, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 514, 31774, 3006, 12, 780, 1058, 16, 31108, 1803, 1046, 22535, 13, 288, 3639, 775, 288, 5411, 7630, 400, 273, 22535, 18, 588, 4747, 921, 7675, 896, 1420, 12, 3146, 16, 21082, 18, ...
if (abc.main.Debug.v().cleanupAfterAdviceWeave)
public void weaveAdvice() { PointcutCodeGen pg = new PointcutCodeGen(); GenStaticJoinPoints gsjp = new GenStaticJoinPoints(); for( Iterator clIt = abc.main.Main.v().getAbcExtension().getGlobalAspectInfo().getWeavableClasses().iterator(); clIt.hasNext(); ) { final AbcClass cl = (AbcClass) clIt.next(); final SootClass scl = cl.getSootClass(); debug("--------- STARTING WEAVING OF CLASS >>>>> " + scl.getName()); // PASS 1 --------- (no init or preinit)-------------------- // generate the Static Join Points gsjp.genStaticJoinPoints(scl); // print out advice info for debugging if (abc.main.Debug.v().printAdviceInfo) PrintAdviceInfo.printAdviceInfo(scl); // pass one of weaver, pg.weaveInAspectsPass(scl, 1); // PASS 2 ----------- (handle init and preinit) ------------- // then do the weaving pg.weaveInAspectsPass(scl, 2); debug("--------- FINISHED WEAVING OF CLASS >>>>> " + scl.getName() + "\n"); } // each class // around advice applying to around advice (adviceexecution) is woven in last pg.weaveInAroundAdviceExecutionsPass(); //if (false) for( Iterator clIt = abc.main.Main.v().getAbcExtension().getGlobalAspectInfo().getWeavableClasses().iterator(); clIt.hasNext(); ) { final AbcClass cl = (AbcClass) clIt.next(); for( Iterator mIt = cl.getSootClass().getMethods().iterator(); mIt.hasNext(); ) { final SootMethod m = (SootMethod) mIt.next(); if( !m.hasActiveBody() ) continue; Body b = m.getActiveBody(); CopyPropagator.v().transform(b); ConstantPropagatorAndFolder.v().transform(b); DeadAssignmentEliminator.v().transform(b); UnusedLocalEliminator.v().transform(b); } } AbcTimer.mark("Weaving advice"); abc.main.Main.phaseDebug("Weaving advice"); } // method weave
236 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/236/33dad3b9ca2d7e9f8d19d009b752dbb2aa395773/Weaver.java/clean/aop/abc/src/abc/weaving/weaver/Weaver.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 309, 261, 18947, 18, 5254, 18, 2829, 18, 90, 7675, 16732, 4436, 1871, 633, 3218, 836, 13, 309, 261, 18947, 18, 5254, 18, 2829, 18, 90, 7675, 16732, 4436, 1871, 633, 3218, 836, 13, 309, 261, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 309, 261, 18947, 18, 5254, 18, 2829, 18, 90, 7675, 16732, 4436, 1871, 633, 3218, 836, 13, 309, 261, 18947, 18, 5254, 18, 2829, 18, 90, 7675, 16732, 4436, 1871, 633, 3218, 836, 13, 309, 261, ...
componentsByDomain.put(subdomain, externalComponent); components.put(component, externalComponent);
componentsByDomain.remove(subdomain); components.remove(component);
public void addComponent(String subdomain, Component component) throws ComponentException { if (componentsByDomain.containsKey(subdomain)) { if (componentsByDomain.get(subdomain).getComponent() == component) { // Do nothing since the component has already been registered return; } else { throw new IllegalArgumentException("Subdomain already in use by another component"); } } // Find the proper secret key to connect as the subdomain. String secretKey = secretKeys.get(subdomain); if (secretKey == null) { secretKey = defaultSecretKey; } // Create a wrapping ExternalComponent on the component ExternalComponent externalComponent = new ExternalComponent(component, this); try { // Register the new component componentsByDomain.put(subdomain, externalComponent); components.put(component, externalComponent); // Ask the ExternalComponent to connect with the remote server externalComponent.connect(host, port, SocketFactory.getDefault(), subdomain); } catch (ComponentException e) { // Unregister the new component componentsByDomain.put(subdomain, externalComponent); components.put(component, externalComponent); // Re-throw the exception throw e; } // Initialize the component JID componentJID = new JID(null, externalComponent.getDomain(), null); externalComponent.initialize(componentJID, this); // Asl the external component to start processing incoming packets externalComponent.start(); }
8076 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/8076/61d1b1adf6b0236d58ac96a7bb5583cfbe132a4e/ExternalComponentManager.java/clean/source/java/org/jivesoftware/whack/ExternalComponentManager.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 15218, 12, 780, 16242, 16, 5435, 1794, 13, 1216, 5435, 503, 288, 3639, 309, 261, 8119, 858, 3748, 18, 12298, 653, 12, 30449, 3719, 288, 5411, 309, 261, 8119, 858, 3748, 18, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 15218, 12, 780, 16242, 16, 5435, 1794, 13, 1216, 5435, 503, 288, 3639, 309, 261, 8119, 858, 3748, 18, 12298, 653, 12, 30449, 3719, 288, 5411, 309, 261, 8119, 858, 3748, 18, 5...
ByteArrayOutputStream os = new ByteArrayOutputStream(); InputStream in = new FileInputStream(args[1]);
os = new ByteArrayOutputStream(); in = new FileInputStream(args[1]);
public static void main(String[] args) { if (args.length != 3) { System.out.println("Usage: HexStrToBin enc/dec <infileName> <outfilename>"); System.exit(1); } try { ByteArrayOutputStream os = new ByteArrayOutputStream(); InputStream in = new FileInputStream(args[1]); int len = 0; byte[] buf = new byte[1024]; while ((len = in.read(buf)) > 0) { os.write(buf, 0, len); } in.close(); os.close(); byte[] data = null; if (args[0].equals("dec")) { data = decode(os.toString()); } else { String strData = encode(os.toByteArray()); data = strData.getBytes(); } FileOutputStream fos = new FileOutputStream(args[2]); fos.write(data); fos.close(); } catch (Exception e) { e.printStackTrace(); } }
4109 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/4109/31d6aba7523c1171d3298c2d2f27b963fa299bfc/Hex.java/buggy/src/java/se/anatom/ejbca/util/Hex.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 918, 2774, 12, 780, 8526, 833, 13, 288, 3639, 309, 261, 1968, 18, 2469, 480, 890, 13, 288, 5411, 2332, 18, 659, 18, 8222, 2932, 5357, 30, 15734, 1585, 774, 9913, 2446, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 918, 2774, 12, 780, 8526, 833, 13, 288, 3639, 309, 261, 1968, 18, 2469, 480, 890, 13, 288, 5411, 2332, 18, 659, 18, 8222, 2932, 5357, 30, 15734, 1585, 774, 9913, 2446, 19, ...
private void _addHighlight(int from, int to) throws BadLocationException { _matchHighlight = getHighlighter().addHighlight(from, to, _highlightPainter); }
private void _addHighlight(int from, int to) throws BadLocationException { _matchHighlight = getHighlighter().addHighlight(from, to, _highlightPainter); }
private void _addHighlight(int from, int to) throws BadLocationException { _matchHighlight = getHighlighter().addHighlight(from, to, _highlightPainter); }
11192 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/11192/e325016b29b8dde8e3ba0908ae34d55edb22c64f/DefinitionsPane.java/buggy/drjava/src/edu/rice/cs/drjava/ui/DefinitionsPane.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1152, 918, 389, 1289, 16205, 12, 474, 628, 16, 509, 358, 13, 1216, 202, 202, 6434, 2735, 503, 288, 202, 202, 67, 1916, 16205, 273, 4405, 202, 588, 8573, 23624, 7675, 1289, 16205, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1152, 918, 389, 1289, 16205, 12, 474, 628, 16, 509, 358, 13, 1216, 202, 202, 6434, 2735, 503, 288, 202, 202, 67, 1916, 16205, 273, 4405, 202, 588, 8573, 23624, 7675, 1289, 16205, 1...
assertEquals("caaaaatcttctagtttttttttagaaaggatacaccaagtagacgattgtttactttac" + "acgccggaaatgaaaaccgcaatggtgctcaaggcaaaagacgttatccgccgtggctgt" + "ctggaatacgacgtcagcgccaccgacatcaccagctcgtttatggctatccgcaagacc" + "atgaccagcagcggacgcagcgccacctatgaggccagccgcagcgaggaagccagccac" + "gccgacctcgcctgggcgaccatgcacgccctgttaaatgagccactcaccgccggtatc" + "agcaccccgctgacatccaccattctggagttttacaccgccagcggcccgaaaatggag" + "gcattcacctttggtgagccggtgccggtactcgaccgccgtgacattctggattacgtc" + "gagtgcatcagtaacggcagatggtatgagccaccggtcagctttaccggtctggcaaaa" + "agcctgcgggctgccgtgcatcacagctcgccgatttacgtcaaacgcaatattctggcc" + "tcgacatttatcccgcatccatggctttcccagcaggatttcagccgctttgtgctggat" + "tttctggtgttcggtaatgcgtttctggaaaagcgttacagcaccaccggtaaggtcatc" + "agactggaaacctcaccggcaaaatatacccgccgtggcgtggaagaggatgtttactgg" + "tgggtgccgtccttcaacgagccgacagccttcgcgcccggctccgtgtttcacctgctg" + "gagccggatattaatcaggagctgtacggcctgccggaatatctcagcgcccttaactct" + "gcctggc", resTranscript0.getSequence().getResidues());
String expectedResidues0 = expectedExonSequence1 + expectedExonSequence2 + expectedExonSequence3; assertEquals(expectedResidues0, resTranscript0.getSequence().getResidues());
public void checkTranscriptSequences() throws Exception { osw.flushObjectById(); ObjectStore os = osw.getObjectStore(); Transcript resTranscript0 = (Transcript) os.getObjectById(storedTranscripts[0].getId()); assertEquals("caaaaatcttctagtttttttttagaaaggatacaccaagtagacgattgtttactttac" + "acgccggaaatgaaaaccgcaatggtgctcaaggcaaaagacgttatccgccgtggctgt" + "ctggaatacgacgtcagcgccaccgacatcaccagctcgtttatggctatccgcaagacc" + "atgaccagcagcggacgcagcgccacctatgaggccagccgcagcgaggaagccagccac" + "gccgacctcgcctgggcgaccatgcacgccctgttaaatgagccactcaccgccggtatc" + "agcaccccgctgacatccaccattctggagttttacaccgccagcggcccgaaaatggag" + "gcattcacctttggtgagccggtgccggtactcgaccgccgtgacattctggattacgtc" + "gagtgcatcagtaacggcagatggtatgagccaccggtcagctttaccggtctggcaaaa" + "agcctgcgggctgccgtgcatcacagctcgccgatttacgtcaaacgcaatattctggcc" + "tcgacatttatcccgcatccatggctttcccagcaggatttcagccgctttgtgctggat" + "tttctggtgttcggtaatgcgtttctggaaaagcgttacagcaccaccggtaaggtcatc" + "agactggaaacctcaccggcaaaatatacccgccgtggcgtggaagaggatgtttactgg" + "tgggtgccgtccttcaacgagccgacagccttcgcgcccggctccgtgtttcacctgctg" + "gagccggatattaatcaggagctgtacggcctgccggaatatctcagcgcccttaactct" + "gcctggc", resTranscript0.getSequence().getResidues()); Transcript resTranscript1 = (Transcript) os.getObjectById(storedTranscripts[1].getId()); assertEquals("cggggaaagcactgcgcgctgacggtggtgctgattgtattttttcagcgtctcagcgcg" + "tcgtgacggcacttagtctgcccgttgaggcgttgtgtgtctgcggggtgttttgtgcgg" + "tggtgagcgtgaaggggatgcggtgcgcgtccagcaggtcagcggcgctggcttttttga" + "tattaaaaaaatcgtccttcgtcgccacttcactgagggggataattttaatgccgtcgg" + "ctttcccctgtggggca", resTranscript1.getSequence().getResidues()); }
29158 /local/tlutelli/issta_data/temp/all_java2context/java/2006_temp/2006/29158/cc67e167d61396f7d90ae94b352e7d3c6ca07a00/TransferSequencesTest.java/clean/flymine/model/genomic/src/test/org/flymine/postprocess/TransferSequencesTest.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 866, 1429, 9118, 21710, 1435, 1216, 1185, 288, 3639, 1140, 91, 18, 11330, 921, 5132, 5621, 3639, 1033, 2257, 1140, 273, 1140, 91, 18, 588, 921, 2257, 5621, 3639, 2604, 9118, 40...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 866, 1429, 9118, 21710, 1435, 1216, 1185, 288, 3639, 1140, 91, 18, 11330, 921, 5132, 5621, 3639, 1033, 2257, 1140, 273, 1140, 91, 18, 588, 921, 2257, 5621, 3639, 2604, 9118, 40...
final String errorString = (String)iter.next();
final String errorString = (String)iter.next();
private void checkErrorMessage(String basePDLName, Collection errorKeywords, Collection failures) throws Exception { s_log.info("Checking bad pdl: " + basePDLName); try { MetadataRoot r = MetadataRoot.getMetadataRoot(); PDL pdl = getPDL(basePDLName); pdl.generateMetadata(r); if (true) { s_log.info(basePDLName + " AST dump:"); System.out.print(pdl.getAST()); } } catch (Throwable e) { //s_log.info(basePDLName + " error " + e.getMessage()); String s = e.toString(); Iterator iter = errorKeywords.iterator(); while(iter.hasNext()) { final String errorString = (String)iter.next(); if (s.indexOf(errorString) < 0) { failures.add("error message for " + basePDLName + " does not contain \"" + errorString + "\"; error message:\n" + s); } } return; } // This can't be in the try clause because then it would // be caught. failures.add("no exception for " + basePDLName); }
12196 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/12196/558097820abc0198518796cedde797658cda9a5e/PDLTest.java/buggy/archive/core-platform/test/src/com/arsdigita/persistence/pdl/PDLTest.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 866, 14935, 12, 780, 1026, 52, 8914, 461, 16, 3639, 2200, 555, 14149, 16, 3639, 2200, 11720, 13, 565, 1216, 1185, 565, 288, 3639, 272, 67, 1330, 18, 1376, 2932, 14294, 5570, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 866, 14935, 12, 780, 1026, 52, 8914, 461, 16, 3639, 2200, 555, 14149, 16, 3639, 2200, 11720, 13, 565, 1216, 1185, 565, 288, 3639, 272, 67, 1330, 18, 1376, 2932, 14294, 5570, ...
public RectangleAnimation(Composite whereToDraw, Rectangle start, Rectangle end, int duration) { super(WorkbenchMessages.getString("RectangleAnimation.Animating_Rectangle")); this.duration = duration; this.start = start; this.end = end; setSystem(true); String platform = SWT.getPlatform(); if (!"win32".equals(platform)) { return; } this.canvas = new Canvas(whereToDraw, SWT.NO_BACKGROUND); canvas.setBounds(whereToDraw.getClientArea()); canvas.addPaintListener(new PaintListener() { public void paintControl(PaintEvent event) { draw(event.gc); } }); canvas.moveAbove(null);
public RectangleAnimation(Shell parentShell, Rectangle start, Rectangle end) { this(parentShell, start, end, 400);
public RectangleAnimation(Composite whereToDraw, Rectangle start, Rectangle end, int duration) { super(WorkbenchMessages.getString("RectangleAnimation.Animating_Rectangle")); //$NON-NLS-1$ this.duration = duration; this.start = start; this.end = end; setSystem(true); // Determine if we're on a platform where animations look ugly. // If so, we indicate this by setting canvas=null, in which case this job does nothing. String platform = SWT.getPlatform(); if (!"win32".equals(platform)) { //$NON-NLS-1$ return; } this.canvas = new Canvas(whereToDraw, SWT.NO_BACKGROUND); canvas.setBounds(whereToDraw.getClientArea()); canvas.addPaintListener(new PaintListener() { public void paintControl(PaintEvent event) { draw(event.gc); } }); canvas.moveAbove(null); }
57470 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/57470/2b1161e241896a70e75a2b2503368dfadba68dbd/RectangleAnimation.java/buggy/bundles/org.eclipse.ui.workbench/Eclipse UI/org/eclipse/ui/internal/RectangleAnimation.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 13264, 10816, 12, 9400, 1625, 774, 6493, 16, 13264, 787, 16, 13264, 679, 16, 509, 3734, 13, 288, 202, 202, 9565, 12, 2421, 22144, 5058, 18, 588, 780, 2932, 19463, 10816, 18, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 13264, 10816, 12, 9400, 1625, 774, 6493, 16, 13264, 787, 16, 13264, 679, 16, 509, 3734, 13, 288, 202, 202, 9565, 12, 2421, 22144, 5058, 18, 588, 780, 2932, 19463, 10816, 18, 2...
return null;
return AbstractIndexer.bestFunctionPrefix( _limitTo, simpleName, _matchMode, _caseSensitive );
public char[] indexEntryPrefix() { // TODO Auto-generated method stub return null; }
6192 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/6192/7a408c3e1d654808f080fcb472cdcf92f1938829/FunctionDeclarationPattern.java/buggy/core/org.eclipse.cdt.core/search/org/eclipse/cdt/internal/core/search/matching/FunctionDeclarationPattern.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 1149, 8526, 770, 1622, 2244, 1435, 288, 202, 202, 759, 2660, 8064, 17, 11168, 707, 7168, 202, 202, 2463, 446, 31, 202, 97, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 1149, 8526, 770, 1622, 2244, 1435, 288, 202, 202, 759, 2660, 8064, 17, 11168, 707, 7168, 202, 202, 2463, 446, 31, 202, 97, 2, -100, -100, -100, -100, -100, -100, -100, -100, -...
{ return createInsetsAdapter(); }
{ return createInsetsAdapter(); }
public Object caseInsets(Insets object) { return createInsetsAdapter(); }
46013 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/46013/e5c78f0e8317166d02fa384e14c3dd7aa1796f2c/AttributeAdapterFactory.java/buggy/chart/org.eclipse.birt.chart.engine/src/org/eclipse/birt/chart/model/attribute/util/AttributeAdapterFactory.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 1033, 648, 382, 4424, 12, 382, 4424, 733, 13, 5411, 288, 7734, 327, 752, 382, 4424, 4216, 5621, 5411, 289, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 1033, 648, 382, 4424, 12, 382, 4424, 733, 13, 5411, 288, 7734, 327, 752, 382, 4424, 4216, 5621, 5411, 289, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100...
dX1 -= ( bTicksLeft ? TICK_SIZE : 0 ) + dYAxisLabelsThickness;
dX1 -= ( bTicksLeft ? TICK_SIZE : 0 ) + Math.max( dYAxisLabelsThickness, dDecorationThickness[0] );
protected final double adjustHorizontal( double dBlockX, double dBlockWidth, AllAxes aax ) throws ChartException, IllegalArgumentException { final OneAxis axPH = aax.areAxesSwapped( ) ? aax.getPrimaryOrthogonal( ) : aax.getPrimaryBase( ); final OneAxis axPV = aax.areAxesSwapped( ) ? aax.getPrimaryBase( ) : aax.getPrimaryOrthogonal( ); final AutoScale scX = axPH.getScale( ); final AutoScale scY = axPV.getScale( ); final int iXLabelLocation = axPH.getLabelPosition( ); final int iYLabelLocation = axPV.getLabelPosition( ); final int iYTitleLocation = axPV.getTitlePosition( ); final Label laXAxisLabels = axPH.getLabel( ); final Label laYAxisLabels = axPV.getLabel( ); final Label laYAxisTitle = axPV.getTitle( ); final int iYTickStyle = axPV.getCombinedTickStyle( ); final IntersectionValue iv = axPV.getIntersectionValue( ); // COMPUTE THE THICKNESS OF THE AXIS INCLUDING AXIS LABEL BOUNDS AND // AXIS-PLOT SPACING final boolean bTicksLeft = ( iYTickStyle & TICK_LEFT ) == TICK_LEFT; final boolean bTicksRight = ( iYTickStyle & TICK_RIGHT ) == TICK_RIGHT; final double dAppliedYAxisPlotSpacing = ( iv.iType == IntersectionValue.MAX || iv.iType == IntersectionValue.MIN ) ? dYAxisPlotSpacing : 0; // UPDATE Y-AXIS ENDPOINTS DUE TO AXIS LABEL SHIFTS double dStart = scY.getStart( ), dEnd = scY.getEnd( ); scY.computeTicks( ids, laYAxisLabels, iYLabelLocation, VERTICAL, dStart, dEnd, true, aax ); if ( !scY.isStepFixed( ) ) { final Object[] oaMinMax = scY.getMinMax( ); while ( !scY.checkFit( ids, laYAxisLabels, iYLabelLocation ) ) { if ( !scY.zoomOut( ) ) { break; } scY.updateAxisMinMax( oaMinMax[0], oaMinMax[1] ); int tickCount = scY.computeTicks( ids, laYAxisLabels, iYLabelLocation, VERTICAL, dStart, dEnd, true, aax ); if ( scY.getUnit( ) != null && asInteger( scY.getUnit( ) ) == Calendar.YEAR && tickCount <= 3 ) { break; } } } double dYAxisLabelsThickness = scY.computeAxisLabelThickness( ids, axPV.getLabel( ), VERTICAL ); double dYAxisTitleThickness = 0; if ( laYAxisTitle.isVisible( ) ) { final String sPreviousValue = laYAxisTitle.getCaption( ).getValue( ); laYAxisTitle.getCaption( ) .setValue( rtc.externalizedMessage( sPreviousValue ) ); try { dYAxisTitleThickness = computeBox( ids, iYTitleLocation, laYAxisTitle, 0, 0 ).getWidth( ); } catch ( IllegalArgumentException uiex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, uiex ); } finally { laYAxisTitle.getCaption( ).setValue( sPreviousValue ); } } double dX = getLocation( scX, iv ), dX1 = dX, dX2 = dX; // COMPUTE VALUES FOR x1, x, x2 // x = HORIZONTAL LOCATION OF Y-AXIS ALONG PLOT // x1 = LEFT EDGE OF Y-AXIS BAND (DUE TO AXIS LABELS, TITLE, TICKS & // SPACING) // x2 = RIGHT EDGE OF Y-AXIS BAND (DUE TO AXIS LABELS, TITLE, TICKS & // SPACING) if ( iv.iType == IntersectionValue.MIN ) { if ( scX.getDirection( ) == BACKWARD ) { // switch if scale is backward. dX = getLocation( scX, IntersectionValue.MAX_VALUE ); } dX -= dAppliedYAxisPlotSpacing; dX1 = dX; dX2 = dX; if ( bTicksLeft ) { dX1 -= TICK_SIZE; } if ( iYLabelLocation == LEFT ) { dX1 -= dYAxisLabelsThickness; dX2 += Math.max( // IF LABELS ARE LEFT, THEN RIGHT SPACING IS // MAX(RT_TICK_SIZE, HORZ_SPACING) bTicksRight ? TICK_SIZE : 0, dAppliedYAxisPlotSpacing ); } else if ( iYLabelLocation == RIGHT ) { // IF LABELS ARE RIGHT, THEN RIGHT SPACING IS // MAX(RT_TICK_SIZE+AXIS_LBL_THCKNESS, HORZ_SPACING) dX2 += Math.max( ( bTicksRight ? TICK_SIZE : 0 ) + dYAxisLabelsThickness, dAppliedYAxisPlotSpacing ); } if ( iYTitleLocation == LEFT ) { dX1 -= dYAxisTitleThickness; } else if ( iYTitleLocation == RIGHT ) { dX2 += dYAxisTitleThickness; } // ENSURE THAT WE DON'T GO BEHIND THE LEFT PLOT BLOCK EDGE if ( dX1 < dBlockX ) { final double dDelta = ( dBlockX - dX1 ); dX1 = dBlockX; dX += dDelta; dX2 += dDelta; } final double dDeltaX1 = dX - dX1; final double dDeltaX2 = dX2 - dX; // COMPUTE THE Y-AXIS BAND THICKNESS AND ADJUST X2 FOR LABELS BELOW if ( iYLabelLocation == RIGHT ) { // Y-AXIS BAND IS (x1 -> (x+AxisPlotSpacing)) dX2 = ( dX + dAppliedYAxisPlotSpacing ); } dYAxisLabelsThickness = dX2 - dX1; // REUSE VARIABLE // CHECK IF X-AXIS THICKNESS REQUIRES A PLOT HEIGHT RESIZE AT THE // UPPER END scX.computeAxisStartEndShifts( ids, laXAxisLabels, HORIZONTAL, iXLabelLocation, aax ); boolean startEndChanged = false; if ( scX.getDirection( ) == BACKWARD ) { if ( dYAxisLabelsThickness > scX.getEndShift( ) ) { // REDUCE scX's STARTPOINT TO FIT THE Y-AXIS ON THE LEFT dEnd = dX2; startEndChanged = true; } else { dEnd = scX.getEnd( ); } dStart = scX.getStart( ); } else { if ( dYAxisLabelsThickness > scX.getStartShift( ) ) { // REDUCE scX's STARTPOINT TO FIT THE Y-AXIS ON THE LEFT dStart = dX2; startEndChanged = true; } else { dStart = scX.getStart( ); } dEnd = scX.getEnd( ); } scX.resetShifts( ); // LOOP THAT AUTO-RESIZES Y-AXIS AND RE-COMPUTES Y-AXIS LABELS // IF OVERLAPS OCCUR scX.setEndPoints( dStart, dEnd ); if ( scX.getDirection( ) == BACKWARD ) { scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, !startEndChanged, aax ); } else { scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, !startEndChanged, true, aax ); } if ( !scX.isStepFixed( ) ) { final Object[] oaMinMax = scX.getMinMax( ); while ( !scX.checkFit( ids, laXAxisLabels, iXLabelLocation ) ) { if ( !scX.zoomOut( ) ) { break; } scX.updateAxisMinMax( oaMinMax[0], oaMinMax[1] ); int tickCount; if ( scX.getDirection( ) == BACKWARD ) { tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, !startEndChanged, aax ); } else { tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, !startEndChanged, true, aax ); } if ( scX.getUnit( ) != null && asInteger( scX.getUnit( ) ) == Calendar.YEAR && tickCount <= 3 ) { break; } } } // MOVE THE Y-AXIS TO THE LEFT EDGE OF THE PLOT IF SLACK SPACE // EXISTS OR SCALE IS RECOMPUTED if ( scX.getDirection( ) == BACKWARD ) { if ( dYAxisLabelsThickness < scX.getEndShift( ) ) { dX = scX.getEnd( ) - ( dX2 - dX ); } } else { if ( dYAxisLabelsThickness < scX.getStartShift( ) ) { dX = scX.getStart( ) - ( dX2 - dX ); } } dX -= insCA.getLeft( ); dX2 = dX + dDeltaX2; dX1 = dX - dDeltaX1; axPV.setTitleCoordinate( ( iYTitleLocation == LEFT ) ? dX1 - 1 : dX2 + 1 - dYAxisTitleThickness ); } else if ( iv.iType == IntersectionValue.MAX ) { if ( scX.getDirection( ) == BACKWARD ) { // switch if scale is backward. dX = getLocation( scX, IntersectionValue.MIN_VALUE ); } dX += dAppliedYAxisPlotSpacing; dX1 = dX; dX2 = dX; if ( bTicksRight ) { dX2 += TICK_SIZE; } if ( iYLabelLocation == RIGHT ) { dX2 += dYAxisLabelsThickness; dX1 -= Math.max( bTicksLeft ? TICK_SIZE : 0, dAppliedYAxisPlotSpacing ); } else if ( iYLabelLocation == LEFT ) { dX1 -= Math.max( ( bTicksLeft ? TICK_SIZE : 0 ) + dYAxisLabelsThickness, dAppliedYAxisPlotSpacing ); } if ( iYTitleLocation == RIGHT ) { dX2 += dYAxisTitleThickness; } else if ( iYTitleLocation == LEFT ) { dX1 -= dYAxisTitleThickness; } // ENSURE THAT WE DON'T GO AHEAD OF THE RIGHT PLOT BLOCK EDGE if ( dX2 > dBlockX + dBlockWidth ) { final double dDelta = dX2 - ( dBlockX + dBlockWidth ); dX2 = dBlockX + dBlockWidth; dX -= dDelta; dX1 -= dDelta; } final double dDeltaX1 = dX - dX1; final double dDeltaX2 = dX2 - dX; // COMPUTE THE Y-AXIS BAND THICKNESS AND ADJUST X1 IF Y-AXIS LABELS // ARE ON THE LEFT if ( iYLabelLocation == LEFT ) { // Y-AXIS BAND IS ((x-AxisPlotSpacing) -> x2) dX1 = ( dX - dAppliedYAxisPlotSpacing ); } dYAxisLabelsThickness = dX2 - dX1; // REUSE VARIABLE // CHECK IF X-AXIS THICKNESS REQUIRES A PLOT HEIGHT RESIZE AT THE // UPPER END scX.computeAxisStartEndShifts( ids, laXAxisLabels, HORIZONTAL, iXLabelLocation, aax ); boolean startEndChanged = false; if ( scX.getDirection( ) == BACKWARD ) { if ( dYAxisLabelsThickness > scX.getStartShift( ) ) { // REDUCE scX's ENDPOINT TO FIT THE Y-AXIS ON THE RIGHT dStart = dX1; startEndChanged = true; } else { dStart = scX.getStart( ); } dEnd = scX.getEnd( ); } else { if ( dYAxisLabelsThickness > scX.getEndShift( ) ) { // REDUCE scX's ENDPOINT TO FIT THE Y-AXIS ON THE RIGHT dEnd = dX1; startEndChanged = true; } else { dEnd = scX.getEnd( ); } dStart = scX.getStart( ); } scX.resetShifts( ); // LOOP THAT AUTO-RESIZES Y-AXIS AND RE-COMPUTES Y-AXIS LABELS // IF OVERLAPS OCCUR scX.setEndPoints( dStart, dEnd ); if ( scX.getDirection( ) == BACKWARD ) { scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, !startEndChanged, true, aax ); } else { scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, !startEndChanged, aax ); } if ( !scX.isStepFixed( ) ) { final Object[] oaMinMax = scX.getMinMax( ); while ( !scX.checkFit( ids, laXAxisLabels, iXLabelLocation ) ) { if ( !scX.zoomOut( ) ) { break; } scX.updateAxisMinMax( oaMinMax[0], oaMinMax[1] ); int tickCount; if ( scX.getDirection( ) == BACKWARD ) { tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, !startEndChanged, true, aax ); } else { tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, !startEndChanged, aax ); } if ( scX.getUnit( ) != null && asInteger( scX.getUnit( ) ) == Calendar.YEAR && tickCount <= 3 ) { break; } } } // MOVE THE Y-AXIS TO THE LEFT EDGE OF THE PLOT IF SLACK SPACE // EXISTS OR SCALE IS RECOMPUTED if ( scX.getDirection( ) == BACKWARD ) { if ( dYAxisLabelsThickness < scX.getStartShift( ) ) { dX = scX.getStart( ) - ( dX1 - dX ); } } else { if ( dYAxisLabelsThickness < scX.getEndShift( ) ) { dX = scX.getEnd( ) - ( dX1 - dX ); } } dX += insCA.getRight( ); dX2 = dX + dDeltaX2; dX1 = dX - dDeltaX1; axPV.setTitleCoordinate( ( iYTitleLocation == LEFT ) ? dX1 - 1 : dX2 + 1 - dYAxisTitleThickness ); } else { double dDeltaX1 = 0, dDeltaX2 = 0; if ( iYTitleLocation == RIGHT ) { dX2 += dYAxisTitleThickness; } else if ( iYTitleLocation == LEFT ) { dX1 -= dYAxisTitleThickness; } if ( iYLabelLocation == LEFT ) { dX1 -= ( bTicksLeft ? TICK_SIZE : 0 ) + dYAxisLabelsThickness; dX2 += ( bTicksRight ? TICK_SIZE : 0 ); dDeltaX1 = dX - dX1; dDeltaX2 = dX2 - dX; // CHECK IF LEFT EDGE OF Y-AXIS BAND GOES BEHIND THE PLOT LEFT // EDGE if ( dX1 < dBlockX ) { final Object[] oaMinMax = scX.getMinMax( ); boolean bForceBreak = false; // A LOOP THAT ITERATIVELY ATTEMPTS TO ADJUST THE LEFT EDGE // OF THE Y-AXIS LABELS WITH THE LEFT EDGE OF THE PLOT // AND/OR // ENSURE THAT THE START POINT OF THE X-AXIS SCALE IS // SUITABLY POSITIONED do { // CANCEL OUT THE ENDPOINT LABEL SHIFT COMPUTATIONS FROM // THE X-AXIS scX.setEndPoints( scX.getStart( ) - scX.getStartShift( ), scX.getEnd( ) + scX.getEndShift( ) ); // RESTORE scX.resetShifts( ); // APPLY THE AXIS REDUCTION FORMULA W.R.T. X-AXIS // STARTPOINT double[] da = scX.getEndPoints( ); double dT_RI = dBlockX - dX1; // THRESHOLD - // REQUESTEDINTERSECTION if ( scX.getDirection( ) == BACKWARD ) { double dAMin_AMax = da[0] - da[1]; double dAMax_RI = Math.abs( da[0] - dX ); double dDelta = ( dT_RI / dAMax_RI ) * dAMin_AMax; dEnd = da[1] + dDelta; dStart = da[0]; if ( dEnd < dBlockX ) { dEnd = dBlockX; bForceBreak = true; } } else { double dAMin_AMax = da[1] - da[0]; double dAMax_RI = Math.abs( da[1] - dX ); double dDelta = ( dT_RI / dAMax_RI ) * dAMin_AMax; dStart = da[0] + dDelta; dEnd = da[1]; if ( dStart < dBlockX ) { dStart = dBlockX; bForceBreak = true; } } // LOOP THAT AUTO-RESIZES Y-AXIS AND RE-COMPUTES Y-AXIS // LABELS IF OVERLAPS OCCUR scX.setEndPoints( dStart, dEnd ); scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); while ( !scX.checkFit( ids, laXAxisLabels, iXLabelLocation ) ) { if ( !scX.zoomOut( ) ) { bForceBreak = true; break; } scX.updateAxisMinMax( oaMinMax[0], oaMinMax[1] ); int tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); if ( scX.getUnit( ) != null && asInteger( scX.getUnit( ) ) == Calendar.YEAR && tickCount <= 3 ) { bForceBreak = true; break; } } dX = getLocation( scX, iv ); dX1 = dX - dDeltaX1; // RE-CALCULATE X-AXIS BAND LEFT // EDGE } while ( Math.abs( dX1 - dBlockX ) > 1 && !bForceBreak ); } else { // LOOP THAT AUTO-RESIZES Y-AXIS AND RE-COMPUTES Y-AXIS // LABELS IF OVERLAPS OCCUR dStart = scX.getStart( ); dEnd = scX.getEnd( ); scX.setEndPoints( dStart, dEnd ); scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); if ( !scX.isStepFixed( ) ) { final Object[] oaMinMax = scX.getMinMax( ); while ( !scX.checkFit( ids, laXAxisLabels, iXLabelLocation ) ) { if ( !scX.zoomOut( ) ) { break; } scX.updateAxisMinMax( oaMinMax[0], oaMinMax[1] ); int tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); if ( scX.getUnit( ) != null && asInteger( scX.getUnit( ) ) == Calendar.YEAR && tickCount <= 3 ) { break; } } } dX = getLocation( scX, iv ); } dX1 = dX - dDeltaX1; dX2 = dX + dDeltaX2; } else if ( iYLabelLocation == RIGHT ) { dX2 += ( bTicksRight ? TICK_SIZE : 0 ) + dYAxisLabelsThickness; dX1 -= ( bTicksLeft ? TICK_SIZE : 0 ); dDeltaX1 = dX - dX1; dDeltaX2 = dX2 - dX; // CHECK IF RIGHT EDGE OF Y-AXIS BAND GOES BEHIND THE PLOT RIGHT // EDGE if ( dX2 > dBlockX + dBlockWidth ) { final Object[] oaMinMax = scX.getMinMax( ); boolean bForceBreak = false; // A LOOP THAT ITERATIVELY ATTEMPTS TO ADJUST THE RIGHT EDGE // OF THE Y-AXIS LABELS WITH THE RIGHT EDGE OF THE PLOT // AND/OR // ENSURE THAT THE START POINT OF THE X-AXIS SCALE IS // SUITABLY POSITIONED do { // CANCEL OUT THE ENDPOINT LABEL SHIFT COMPUTATIONS FROM // THE X-AXIS scX.setEndPoints( scX.getStart( ) - scX.getStartShift( ), scX.getEnd( ) + scX.getEndShift( ) ); // RESTORE scX.resetShifts( ); // APPLY THE AXIS REDUCTION FORMULA W.R.T. X-AXIS // ENDPOINT double[] da = scX.getEndPoints( ); double dT_RI = dX2 - ( dBlockX + dBlockWidth ); // THRESHOLD // - // REQUESTEDINTERSECTION if ( scX.getDirection( ) == BACKWARD ) { double dAMin_AMax = da[0] - da[1]; double dAMin_RI = Math.abs( dX - da[1] ); double dDelta = Math.abs( dT_RI / dAMin_RI ) * dAMin_AMax; dStart = da[0] - dDelta; dEnd = da[1]; if ( dStart > dBlockX + dBlockWidth ) { dStart = dBlockX + dBlockWidth; bForceBreak = true; } } else { double dAMin_AMax = da[1] - da[0]; double dAMin_RI = Math.abs( dX - da[0] ); double dDelta = ( dT_RI / dAMin_RI ) * dAMin_AMax; dEnd = da[1] - dDelta; dStart = da[0]; if ( dEnd > dBlockX + dBlockWidth ) { dEnd = dBlockX + dBlockWidth; bForceBreak = true; } } // LOOP THAT AUTO-RESIZES Y-AXIS AND RE-COMPUTES Y-AXIS // LABELS IF OVERLAPS OCCUR scX.setEndPoints( dStart, dEnd ); scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); if ( !scX.isStepFixed( ) ) { while ( !scX.checkFit( ids, laXAxisLabels, iXLabelLocation ) ) { if ( !scX.zoomOut( ) ) { bForceBreak = true; break; } scX.updateAxisMinMax( oaMinMax[0], oaMinMax[1] ); int tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); if ( scX.getUnit( ) != null && asInteger( scX.getUnit( ) ) == Calendar.YEAR && tickCount <= 3 ) { bForceBreak = true; break; } } } dX = getLocation( scX, iv ); dX2 = dX + dDeltaX2; // RE-CALCULATE X-AXIS BAND // RIGHT // EDGE } while ( Math.abs( dX2 - ( dBlockX + dBlockWidth ) ) > 1 && !bForceBreak ); } else { // LOOP THAT AUTO-RESIZES Y-AXIS AND RE-COMPUTES Y-AXIS // LABELS IF OVERLAPS OCCUR dStart = scX.getStart( ); dEnd = scX.getEnd( ); scX.setEndPoints( dStart, dEnd ); scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); if ( !scX.isStepFixed( ) ) { final Object[] oaMinMax = scX.getMinMax( ); while ( !scX.checkFit( ids, laXAxisLabels, iXLabelLocation ) ) { if ( !scX.zoomOut( ) ) { break; } scX.updateAxisMinMax( oaMinMax[0], oaMinMax[1] ); int tickCount = scX.computeTicks( ids, laXAxisLabels, iXLabelLocation, HORIZONTAL, dStart, dEnd, true, aax ); if ( scX.getUnit( ) != null && asInteger( scX.getUnit( ) ) == Calendar.YEAR && tickCount <= 3 ) { break; } } } dX = getLocation( scX, iv ); } dX2 = dX + dDeltaX2; dX1 = dX - dDeltaX1; } axPV.setTitleCoordinate( ( iYTitleLocation == LEFT ) ? dX1 - 1 : dX2 + 1 - dYAxisTitleThickness ); } return dX; }
15160 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/15160/20bb7679d106e8105100c095c900612d5a37a46d/PlotWithAxes.java/buggy/chart/org.eclipse.birt.chart.engine/src/org/eclipse/birt/chart/computation/withaxes/PlotWithAxes.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 727, 1645, 5765, 14457, 12, 1645, 302, 1768, 60, 16, 1082, 202, 9056, 302, 1768, 2384, 16, 4826, 26494, 279, 651, 262, 1216, 14804, 503, 16, 1082, 202, 31237, 202, 95, 202, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 727, 1645, 5765, 14457, 12, 1645, 302, 1768, 60, 16, 1082, 202, 9056, 302, 1768, 2384, 16, 4826, 26494, 279, 651, 262, 1216, 14804, 503, 16, 1082, 202, 31237, 202, 95, 202, 2...
Game.UNIT_IN_RETREAT);
Entity.REMOVE_IN_RETREAT);
private void resolveDfaAttack(DfaAttackAction daa, int lastEntityId) { final Entity ae = game.getEntity(daa.getEntityId()); final Targetable target = game.getTarget(daa.getTargetType(), daa.getTargetId()); Entity te = null; if (target != null && target.getTargetType() == Targetable.TYPE_ENTITY) { te = (Entity)target; } // Which building takes the damage? Building bldg = game.board.getBuildingAt( daa.getTargetPos() ); // is the attacker dead? because that sure messes up the calculations if (ae == null) { return; } final int direction = ae.getFacing(); if (lastEntityId != daa.getEntityId()) { phaseReport.append("\nPhysical attacks for " ).append( ae.getDisplayName() ).append( "\n"); } // entity isn't charging any more ae.setDisplacementAttack(null); // should we even bother? if (target == null || (target.getTargetType() == Targetable.TYPE_ENTITY && (te.isDestroyed() || te.isDoomed() || te.crew.isDead()))) { phaseReport.append(" Death from above deals no damage as the target has been destroyed.\n"); if (ae.isProne()) { // attacker prone during weapons phase doEntityFall(ae, daa.getTargetPos(), 2, 3, Compute.getBasePilotingRoll(game, ae.getId())); } else { // same effect as successful DFA doEntityDisplacement(ae, ae.getPosition(), daa.getTargetPos(), new PilotingRollData(ae.getId(), 4, "executed death from above")); } return; } phaseReport.append(" Attempting death from above on " ).append( target.getDisplayName()); // target still in the same position? if ( !target.getPosition().equals(daa.getTargetPos()) ) { phaseReport.append(" but the target has moved.\n"); return; } // compute to-hit ToHitData toHit = Compute.toHitDfa(game, daa); // hack: if the attacker's prone, or incapacitated, fudge the roll int roll; if (ae.isProne() || !ae.isActive()) { roll = -12; phaseReport.append(" but the attacker is prone or incapacitated : "); } else if (toHit.getValue() == ToHitData.IMPOSSIBLE) { roll = -12; phaseReport.append(" but the attack is impossible (" ).append( toHit.getDesc() ).append( ") : "); } else if (toHit.getValue() == ToHitData.AUTOMATIC_SUCCESS) { phaseReport.append(", the DFA is an automatic hit (" ).append( toHit.getDesc() ).append( "), "); roll = Integer.MAX_VALUE; } else { // roll roll = Compute.d6(2); phaseReport.append("; needs " ).append( toHit.getValue() ).append( ", "); phaseReport.append("rolls " ).append( roll ).append( " : "); } // do we hit? if (roll < toHit.getValue()) { Coords dest = te.getPosition(); Coords targetDest = Compute.getPreferredDisplacement(game, te.getId(), dest, direction); phaseReport.append("misses.\n"); if (targetDest != null) { // attacker falls into destination hex phaseReport.append(ae.getDisplayName() ).append( " falls into hex " ).append( dest.getBoardNum() ).append( ".\n"); doEntityFall(ae, dest, 2, 3, Compute.getBasePilotingRoll(game, ae.getId())); // move target to preferred hex doEntityDisplacement(te, dest, targetDest, null); } else { // attacker destroyed phaseReport.append(destroyEntity(ae, "impossible displacement", false)); } return; } // we hit... // Can't DFA a target inside of a building. int damage = Compute.getDfaDamageFor(ae); int damageTaken = Compute.getDfaDamageTakenBy(ae); phaseReport.append("hits."); // Targeting a building. if ( target.getTargetType() == Targetable.TYPE_BUILDING ) { // The building takes the full brunt of the attack. phaseReport.append( "\n " ) .append( damageBuilding( bldg, damage ) ) .append( "\n" ); // Damage any infantry in the hex. this.damageInfantryIn( bldg, damage ); } // Target isn't building. else { phaseReport.append("\n Defender takes " ).append( damage ).append( " damage" ).append( toHit.getTableDesc() ).append( "."); while (damage > 0) { int cluster = Math.min(5, damage); HitData hit = te.rollHitLocation(toHit.getHitTable(), toHit.getSideTable()); phaseReport.append(damageEntity(te, hit, cluster)); damage -= cluster; } } phaseReport.append("\n Attacker takes " ).append( damageTaken ).append( " damage."); while (damageTaken > 0) { int cluster = Math.min(5, damageTaken); HitData hit = ae.rollHitLocation(ToHitData.HIT_KICK, toHit.SIDE_FRONT); phaseReport.append(damageEntity(ae, hit, cluster)); damageTaken -= cluster; } phaseReport.append("\n"); // That's it for target buildings. // TODO: where do I put the attacker?!? if ( target.getTargetType() == Targetable.TYPE_BUILDING ) { return; } // Target entities are pushed away or destroyed. Coords dest = te.getPosition(); Coords targetDest = Compute.getValidDisplacement(game, te.getId(), dest, direction); if (game.getOptions().booleanOption("push_off_board") && !game.board.contains(dest.translated(direction))) { game.removeEntity(te.getId(), Game.UNIT_IN_RETREAT); send(createRemoveEntityPacket(te.getId(), Game.UNIT_IN_RETREAT)); phaseReport.append("\n*** " ).append( te.getDisplayName() ).append( " target has been forced from the field. ***\n"); } else { if (targetDest != null) { doEntityDisplacement(te, dest, targetDest, new PilotingRollData(te.getId(), 2, "hit by death from above")); } else { // ack! automatic death! phaseReport.append(destroyEntity(te, "impossible displacement", false)); } } // HACK: to avoid automatic falls, displace from dest to dest doEntityDisplacement(ae, dest, dest, new PilotingRollData(ae.getId(), 4, "executed death from above")); }
4135 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/4135/7b156cd8b6cf94abce0d471a11632786a780a2ac/Server.java/clean/megamek/src/megamek/server/Server.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 2245, 40, 507, 3075, 484, 12, 40, 507, 3075, 484, 1803, 5248, 69, 16, 509, 1142, 18029, 13, 288, 3639, 727, 3887, 14221, 273, 7920, 18, 588, 1943, 12, 2414, 69, 18, 588, 18...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 2245, 40, 507, 3075, 484, 12, 40, 507, 3075, 484, 1803, 5248, 69, 16, 509, 1142, 18029, 13, 288, 3639, 727, 3887, 14221, 273, 7920, 18, 588, 1943, 12, 2414, 69, 18, 588, 18...
LaterInvocator.leaveModal(ProgressIndicatorBase.this);
doExitModality();
public void run() { LaterInvocator.leaveModal(ProgressIndicatorBase.this); }
17306 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/17306/c177b16e8fadce8e8c13a717beccc94a7858519e/ProgressIndicatorBase.java/buggy/ui/impl/com/intellij/openapi/progress/util/ProgressIndicatorBase.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 918, 1086, 1435, 288, 2868, 741, 6767, 1739, 7919, 5621, 5411, 289, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 918, 1086, 1435, 288, 2868, 741, 6767, 1739, 7919, 5621, 5411, 289, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -10...
if ( async ) {
if (async) {
public static void main(String[] args) throws Exception { System.out.println("Usage java org.apache.james.testing.Main <testconfigfile>"); File testconfFile = new File(args[0]); DefaultConfigurationBuilder builder = new DefaultConfigurationBuilder(); Configuration alltestconf = builder.buildFromFile(testconfFile); Configuration[] testconf = alltestconf.getChildren("test"); TestSuite alltests = new TestSuite(); for ( int i = 0 ; i < testconf.length ; i++ ) { Configuration conf = testconf[i]; String clsname = conf.getAttribute("class"); String name = conf.getAttribute("name"); int repetition = conf.getAttributeAsInteger("repetition"); boolean async = conf.getAttributeAsBoolean("async"); Class clazz = Class.forName(clsname); Constructor cstr = clazz.getConstructor(new Class[] { String.class }); Test test = (Test)cstr.newInstance(new Object[] {name}); if ( test instanceof Configurable ) { ((Configurable)test).configure(conf); } if (repetition > 1) { test = new RepeatedTest(test,repetition); } if ( async ) { TestSuite ts = new ActiveTestSuite(); ts.addTest(test); test = ts; } alltests.addTest(test); } TestRunner.run(alltests); }
47102 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/47102/bbbef603ffaae5369ab44517117636ee561d3b72/Main.java/buggy/tests/src/java/org/apache/james/testing/Main.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 918, 2774, 12, 780, 8526, 833, 13, 1216, 1185, 288, 3639, 2332, 18, 659, 18, 8222, 2932, 5357, 2252, 2358, 18, 19211, 18, 78, 753, 18, 3813, 310, 18, 6376, 411, 3813, 1425, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 918, 2774, 12, 780, 8526, 833, 13, 1216, 1185, 288, 3639, 2332, 18, 659, 18, 8222, 2932, 5357, 2252, 2358, 18, 19211, 18, 78, 753, 18, 3813, 310, 18, 6376, 411, 3813, 1425, ...
public String getVolumeSetIdentifier() { return volumeSetIdentifier; }
public String getVolumeSetIdentifier() { return volumeSetIdentifier; }
public String getVolumeSetIdentifier() { return volumeSetIdentifier; }
50763 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/50763/aa324658a8e5c25a895787936a31595462ad8442/VolumeDescriptor.java/buggy/fs/src/fs/org/jnode/fs/iso9660/VolumeDescriptor.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 514, 336, 4545, 694, 3004, 1435, 202, 95, 202, 202, 2463, 3940, 694, 3004, 31, 202, 97, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 514, 336, 4545, 694, 3004, 1435, 202, 95, 202, 202, 2463, 3940, 694, 3004, 31, 202, 97, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, ...
public boolean keepConnection() {
public boolean keepConnection(SVNRepository repository) {
public boolean keepConnection() { return false; }
5695 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/5695/f1ee3a99fba995e9050cc58f5e26f058076e96ed/ISVNSession.java/clean/javasvn/src/org/tmatesoft/svn/core/io/ISVNSession.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 540, 1071, 1250, 3455, 1952, 12, 23927, 50, 3305, 3352, 13, 288, 5411, 327, 629, 31, 3639, 289, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 540, 1071, 1250, 3455, 1952, 12, 23927, 50, 3305, 3352, 13, 288, 5411, 327, 629, 31, 3639, 289, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -10...
try { Class.forName("org.postgresql.Driver"); return java.sql.DriverManager.getConnection(getURL(), getUser(), getPassword()); } catch (ClassNotFoundException ex) { TestCase.fail(ex.getMessage()); } catch (SQLException ex) { TestCase.fail(ex.getMessage()); } return null;
return openDB(new Properties());
public static java.sql.Connection openDB() { try { Class.forName("org.postgresql.Driver"); return java.sql.DriverManager.getConnection(getURL(), getUser(), getPassword()); } catch (ClassNotFoundException ex) { TestCase.fail(ex.getMessage()); } catch (SQLException ex) { TestCase.fail(ex.getMessage()); } return null; }
49504 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/49504/b4ed1edb57113c0de4ea881d9688a23b3396d13b/TestUtil.java/clean/src/interfaces/jdbc/org/postgresql/test/TestUtil.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 2252, 18, 4669, 18, 1952, 1696, 2290, 1435, 202, 95, 202, 202, 698, 202, 202, 95, 1082, 202, 797, 18, 1884, 461, 2932, 3341, 18, 2767, 24330, 18, 4668, 8863, 1082, 202, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 2252, 18, 4669, 18, 1952, 1696, 2290, 1435, 202, 95, 202, 202, 698, 202, 202, 95, 1082, 202, 797, 18, 1884, 461, 2932, 3341, 18, 2767, 24330, 18, 4668, 8863, 1082, 202, ...
_logger.debug("Creating class loader");
_logger.debug("Creating class loader");
protected ClassLoader prepareVM(String classname, String[] args) { nodeName = parseNodename(args); ClassLoader cl = null; /* Setting up policy & security manager if there is a policy and security manager then override the set setPolicy & setSecurityManager methods. */ try { /* Set the Java policy for use by the security manager */ _logger.debug("Setting policy"); setPolicy(); /* Set the Java security manager */ if (_logger.isDebugEnabled()) { _logger.debug("Setting security manager"); } setSecurityManager(); /* Create a log file to report JAR file verification failures. This is only used when a secure class loader is set. */ if (_logger.isDebugEnabled()) { _logger.debug("Creating Jar verification log"); } createJarVerificationLog(); /* Create the class loader. Load JAR files securely if * a secure class loader is used. */ if (_logger.isDebugEnabled()) { _logger.debug("Creating class loader"); } cl = super.prepareVM(classname, args); if (_logger.isDebugEnabled()) { _logger.debug("Class Loader:" + cl.getClass().getName()); } /* Load cryptographic providers */ CryptoProviderLoader.getInstance().loadCryptoProviders(cl); } catch (Exception e) { _logger.warn("Failed to launch "+classname, e); } return cl; }
13819 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/13819/1692292974c413c27f3434206c80e4fc515bd58b/BaseBootstrapper.java/clean/securebootstrapper/src/org/cougaar/core/security/securebootstrap/BaseBootstrapper.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 4750, 9403, 2911, 7397, 12, 780, 7479, 16, 514, 8526, 833, 13, 288, 565, 7553, 273, 1109, 50, 369, 1069, 12, 1968, 1769, 565, 9403, 927, 273, 446, 31, 565, 1748, 1377, 13274, 731, 225, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 4750, 9403, 2911, 7397, 12, 780, 7479, 16, 514, 8526, 833, 13, 288, 565, 7553, 273, 1109, 50, 369, 1069, 12, 1968, 1769, 565, 9403, 927, 273, 446, 31, 565, 1748, 1377, 13274, 731, 225, ...
public String getMessage(String code, Object[] args) { return messagesource.getMessage(code, args, localegetter == null ? Locale .getDefault() : localegetter.get());
public String getMessage(String[] codes, Object[] args) { DefaultMessageSourceResolvable dmsr = new DefaultMessageSourceResolvable( codes, args); Locale locale = localegetter == null ? Locale.getDefault() : localegetter.get(); try { return messagesource.getMessage(dmsr, locale); } catch (Exception nsme) { Logger.log.warn("Failed to look up message " + codes[0] + ", falling back to default", nsme); try { if (defaultmessagekey != null) { return messagesource.getMessage(defaultmessagekey, null, locale); } } catch (Exception nsme2) { } } return defaultmessage;
public String getMessage(String code, Object[] args) { return messagesource.getMessage(code, args, localegetter == null ? Locale .getDefault() : localegetter.get()); }
48218 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/48218/9c8c1ef95b985c15f4195e2a747db862bcf88afb/SpringMessageLocator.java/clean/src/uk/org/ponder/springutil/SpringMessageLocator.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 514, 2381, 12, 780, 981, 16, 1033, 8526, 833, 13, 288, 565, 327, 2743, 552, 18, 24906, 12, 710, 16, 833, 16, 2573, 11990, 422, 446, 692, 6458, 3639, 263, 588, 1868, 1435, 3639, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 514, 2381, 12, 780, 981, 16, 1033, 8526, 833, 13, 288, 565, 327, 2743, 552, 18, 24906, 12, 710, 16, 833, 16, 2573, 11990, 422, 446, 692, 6458, 3639, 263, 588, 1868, 1435, 3639, ...
public static ResultUnitAssociation readByOid(Integer oid) {
public final static ResultUnitAssociation readByOid(Integer oid) {
public static ResultUnitAssociation readByOid(Integer oid) { final ResultUnitAssociation association = RootDomainObject.getInstance().readResultUnitAssociationByOID(oid); if (association==null) { throw new DomainException("error.researcher.ResultUnitAssociation.null"); } return association; }
2645 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/2645/f7abe00b5548b12caf61a615516273677cbc5915/ResultUnitAssociation.java/buggy/src/net/sourceforge/fenixedu/domain/research/result/ResultUnitAssociation.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 3438, 2802, 7174, 855, 858, 19105, 12, 4522, 7764, 13, 288, 202, 6385, 3438, 2802, 7174, 6384, 273, 7450, 3748, 921, 18, 588, 1442, 7675, 896, 1253, 2802, 7174, 858, 12945, 12,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 3438, 2802, 7174, 855, 858, 19105, 12, 4522, 7764, 13, 288, 202, 6385, 3438, 2802, 7174, 6384, 273, 7450, 3748, 921, 18, 588, 1442, 7675, 896, 1253, 2802, 7174, 858, 12945, 12,...
saveStructureViewState();
storeState();
public void dispose() { LOG.assertTrue(EventQueue.isDispatchThread(), Thread.currentThread().getName()); saveStructureViewState(); if (myAbstractTreeBuilder != null) { myAbstractTreeBuilder.dispose(); myAbstractTreeBuilder = null; } myFileEditor = null; myAutoScrollFromSourceHandler.dispose(); }
56598 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/56598/a9e359ba28413282c647b0e8080e7d385596e279/StructureViewComponent.java/buggy/source/com/intellij/ide/structureView/newStructureView/StructureViewComponent.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 15825, 1435, 288, 565, 2018, 18, 11231, 5510, 12, 1133, 3183, 18, 291, 5325, 3830, 9334, 4884, 18, 2972, 3830, 7675, 17994, 10663, 282, 1707, 1119, 5621, 282, 309, 261, 4811, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 15825, 1435, 288, 565, 2018, 18, 11231, 5510, 12, 1133, 3183, 18, 291, 5325, 3830, 9334, 4884, 18, 2972, 3830, 7675, 17994, 10663, 282, 1707, 1119, 5621, 282, 309, 261, 4811, 7...
if (lock != null) lock.release();
if (lock != null) lock.release();
public final boolean isMember(Address node) { if (Assert.VERIFY_ASSERTIONS) Assert._assert(isNode(node)); boolean result = false; if (lock != null) lock.acquire(); Address cur = head; while (!cur.isZero()) { if (cur.EQ(node)) { result = true; break; } cur = cur.loadAddress(NEXT_OFFSET); } if (lock != null) lock.release(); return result; }
5245 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/5245/4c66aa27cec27f8dd5902baec018ff86d7f49ee2/DoublyLinkedList.java/buggy/MMTk/src/org/mmtk/utility/DoublyLinkedList.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 727, 1250, 353, 4419, 12, 1887, 756, 13, 288, 565, 309, 261, 8213, 18, 23756, 67, 8423, 11539, 1146, 55, 13, 5452, 6315, 11231, 12, 291, 907, 12, 2159, 10019, 565, 1250, 563, 273,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 727, 1250, 353, 4419, 12, 1887, 756, 13, 288, 565, 309, 261, 8213, 18, 23756, 67, 8423, 11539, 1146, 55, 13, 5452, 6315, 11231, 12, 291, 907, 12, 2159, 10019, 565, 1250, 563, 273,...
while (li.hasNext()) { if ((layer = (MapLayer)li.next()) != null) { float opacity = layer.getOpacity(); if (layer.isVisible() && opacity > 0.0f) { if (opacity < 1.0f) { g2d.setComposite(AlphaComposite.getInstance( AlphaComposite.SRC_ATOP, opacity)); } else { g2d.setComposite(AlphaComposite.SrcOver); } if (layer instanceof TileLayer) { paintLayer(g2d, (TileLayer)layer, currentZoom); } else if (layer instanceof ObjectGroup) { paintLayer(g2d, (ObjectGroup)layer, currentZoom); } } } }
paintSubMap(myMap, g2d, 1.0f);
public void paintComponent(Graphics g) { Graphics2D g2d = (Graphics2D)g.create(); TiledConfiguration conf = TiledConfiguration.getInstance(); double currentZoom = zoom; Iterator li = myMap.getLayers(); MapLayer layer; Rectangle clip = g2d.getClipBounds(); g2d.setStroke(new BasicStroke(2.0f)); // Do an initial fill with the background color try { String colorString = conf.getValue("tiled.background.color"); g2d.setColor(Color.decode(colorString)); } catch (NumberFormatException e) { g2d.setColor(new Color(64, 64, 64)); } g2d.fillRect(clip.x, clip.y, clip.width, clip.height); while (li.hasNext()) { if ((layer = (MapLayer)li.next()) != null) { float opacity = layer.getOpacity(); if (layer.isVisible() && opacity > 0.0f) { if (opacity < 1.0f) { g2d.setComposite(AlphaComposite.getInstance( AlphaComposite.SRC_ATOP, opacity)); } else { g2d.setComposite(AlphaComposite.SrcOver); } if (layer instanceof TileLayer) { paintLayer(g2d, (TileLayer)layer, currentZoom); } else if (layer instanceof ObjectGroup) { paintLayer(g2d, (ObjectGroup)layer, currentZoom); } } } } if (!getMode(PF_NOSPECIAL)) { li = myMap.getLayersSpecial(); while (li.hasNext()) { layer = (MapLayer) li.next(); if (layer.isVisible()) { if (layer instanceof SelectionLayer) { g2d.setComposite(AlphaComposite.getInstance( AlphaComposite.SRC_ATOP, 0.3f)); g2d.setColor( ((SelectionLayer)layer).getHighlightColor()); } paintLayer(g2d, (TileLayer)layer, currentZoom); } } } // Grid color (also used for coordinates) try { String colorString = conf.getValue("tiled.grid.color"); g2d.setColor(Color.decode(colorString)); } catch (NumberFormatException e) { g2d.setColor(Color.black); } if (getMode(PF_GRIDMODE)) { // Grid opacity int opacity = conf.getIntValue("tiled.grid.opacity", 255); if (opacity < 255) { g2d.setComposite(AlphaComposite.getInstance( AlphaComposite.SRC_ATOP, (float)opacity / 255.0f)); } else { g2d.setComposite(AlphaComposite.SrcOver); } // Configure grid antialiasing if (conf.keyHasValue("tiled.grid.antialias", 1)) { g2d.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); } else { g2d.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_OFF); } g2d.setStroke(new BasicStroke()); paintGrid(g2d, currentZoom); } if (getMode(PF_COORDINATES)) { g2d.setComposite(AlphaComposite.SrcOver); paintCoordinates(g2d, zoom); } }
6621 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/6621/11c639cba9326b8dbe4e7446bc856544b84589b1/MapView.java/clean/tiled/view/MapView.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 12574, 1841, 12, 17558, 314, 13, 288, 3639, 16830, 22, 40, 314, 22, 72, 273, 261, 17558, 22, 40, 13, 75, 18, 2640, 5621, 3639, 399, 1411, 1750, 2195, 273, 399, 1411, 1750, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 12574, 1841, 12, 17558, 314, 13, 288, 3639, 16830, 22, 40, 314, 22, 72, 273, 261, 17558, 22, 40, 13, 75, 18, 2640, 5621, 3639, 399, 1411, 1750, 2195, 273, 399, 1411, 1750, ...
public void printCharacterEntityReference(char[] code) throws IOException {
public void printCharacterEntityReference (char[] code, boolean first, boolean preceedingSpace) throws IOException { if ((prettyPrinter.getFormat()) && (xmlSpace.get(0) != Boolean.TRUE)) { if (first) { printNewline(); printString(margin.toString()); } else if (preceedingSpace) { int endCol = column + code.length + 3; if (endCol > prettyPrinter.getDocumentWidth()){ printNewline(); printString(margin.toString()); } else { printCharacter(' '); } } }
public void printCharacterEntityReference(char[] code) throws IOException { printString("&#"); printCharacters(code); printCharacter(';'); }
45946 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/45946/bebad01b866f19c096ef5f10f2a9ca11827bbe45/OutputManager.java/buggy/sources/org/apache/batik/transcoder/svg2svg/OutputManager.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1172, 7069, 1943, 2404, 261, 3001, 8526, 981, 16, 1250, 1122, 16, 1250, 675, 5288, 310, 3819, 13, 1216, 1860, 288, 309, 14015, 19073, 12149, 18, 588, 1630, 10756, 597, 261, 290...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1172, 7069, 1943, 2404, 261, 3001, 8526, 981, 16, 1250, 1122, 16, 1250, 675, 5288, 310, 3819, 13, 1216, 1860, 288, 309, 14015, 19073, 12149, 18, 588, 1630, 10756, 597, 261, 290...
public NamingException (String msg)
public NamingException ()
public NamingException (String msg) { super(msg); }
25337 /local/tlutelli/issta_data/temp/all_java2context/java/2006_temp/2006/25337/daca25b853b52ea5035f6979a325fe030df38870/NamingException.java/buggy/libjava/javax/naming/NamingException.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 26890, 1832, 225, 288, 565, 2240, 12, 3576, 1769, 225, 289, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 26890, 1832, 225, 288, 565, 2240, 12, 3576, 1769, 225, 289, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, ...
Logger.normal(this, "My exponent: "+myExponent.toHexString()+", my exponential: "+myExponential.toHexString()+", peer's exponential: "+peerExponential.toHexString());
public synchronized BlockCipher getCipher() { lastUsedTime = System.currentTimeMillis(); if(cipher != null) return cipher; // Calculate key NativeBigInteger sharedSecret = (NativeBigInteger) peerExponential.modPow(myExponent, group.getP()); MessageDigest md; try { md = MessageDigest.getInstance("SHA-256"); } catch (NoSuchAlgorithmException e) { throw new Error(e); } byte[] digest = md.digest(sharedSecret.toByteArray()); Logger.normal(this, "My exponent: "+myExponent.toHexString()+", my exponential: "+myExponential.toHexString()+", peer's exponential: "+peerExponential.toHexString()); Logger.normal(this, "Key="+HexUtil.bytesToHex(digest)); try { cipher = new Rijndael(256, 256); } catch (UnsupportedCipherException e1) { throw new Error(e1); } cipher.initialize(digest); return cipher; }
46731 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/46731/4701aa9e21c30017ca88796ba43ef53f3e7172a5/DiffieHellmanContext.java/buggy/src/freenet/crypt/DiffieHellmanContext.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 3852, 3914, 13896, 1927, 4337, 1435, 288, 3639, 1142, 6668, 950, 273, 2332, 18, 2972, 28512, 5621, 3639, 309, 12, 17094, 480, 446, 13, 327, 5867, 31, 3639, 368, 9029, 498, 3639, 167...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 3852, 3914, 13896, 1927, 4337, 1435, 288, 3639, 1142, 6668, 950, 273, 2332, 18, 2972, 28512, 5621, 3639, 309, 12, 17094, 480, 446, 13, 327, 5867, 31, 3639, 368, 9029, 498, 3639, 167...
public Object getPreviousValue();
Object getPreviousValue();
public Object getPreviousValue();
50763 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/50763/61b8e27fab61a8487622d1793b61aa19c130c7ab/SpinnerModel.java/clean/core/src/classpath/javax/javax/swing/SpinnerModel.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 1033, 17225, 620, 5621, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 1033, 17225, 620, 5621, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, ...
return new TableBandState( element, TableItem.HEADER_SLOT );
return new TableBandState( element, IListingElementModel.HEADER_SLOT );
public AbstractParseState startElement( String tagName ) { if ( tagName.equalsIgnoreCase( DesignSchemaConstants.COLUMN_TAG ) ) return new TableColumnState( handler, element, TableItem.COLUMN_SLOT ); if ( tagName.equalsIgnoreCase( DesignSchemaConstants.HEADER_TAG ) ) return new TableBandState( element, TableItem.HEADER_SLOT ); if ( tagName.equalsIgnoreCase( DesignSchemaConstants.GROUP_TAG ) ) return new TableGroupState( handler, element, TableItem.GROUP_SLOT ); if ( tagName.equalsIgnoreCase( DesignSchemaConstants.DETAIL_TAG ) ) return new TableBandState( element, TableItem.DETAIL_SLOT ); if ( tagName.equalsIgnoreCase( DesignSchemaConstants.FOOTER_TAG ) ) return new TableBandState( element, TableItem.FOOTER_SLOT ); return super.startElement( tagName ); }
46013 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/46013/d802c33711e0d111551ae23575895cd060f085b6/TableItemState.java/buggy/model/org.eclipse.birt.report.model/src/org/eclipse/birt/report/model/parser/TableItemState.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 4115, 3201, 1119, 13591, 12, 514, 7196, 262, 202, 95, 202, 202, 430, 261, 7196, 18, 14963, 5556, 12, 29703, 3078, 2918, 18, 11009, 67, 7927, 262, 262, 1082, 202, 2463, 394, 35...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 4115, 3201, 1119, 13591, 12, 514, 7196, 262, 202, 95, 202, 202, 430, 261, 7196, 18, 14963, 5556, 12, 29703, 3078, 2918, 18, 11009, 67, 7927, 262, 262, 1082, 202, 2463, 394, 35...
ds.wait(); } catch (InterruptedException ie) {
jobQueueSynchro.wait(); } catch (InterruptedException ie) {
public void run() { while (true) { // Load input data to input queue synchronized (ds) { if (jobQueue.isEmpty()) { jobQueue = genePattern.getWaitingJobs(); } if (jobQueue.isEmpty()) { try { ds.wait(); } catch (InterruptedException ie) { } } } Object o = null; if (!jobQueue.isEmpty()) { o = jobQueue.remove(0); } if (o == null) { continue; } try { onJobProcessFrameWork(o); } catch (Exception ex) { log.error(ex); } } }
57344 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/57344/95a2eab1fe8529b27fcb7c023d56a4f951f94f07/AnalysisTask.java/buggy/src/org/genepattern/server/AnalysisTask.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1086, 1435, 288, 3639, 1323, 261, 3767, 13, 288, 5411, 368, 4444, 810, 501, 358, 810, 2389, 5411, 3852, 261, 2377, 13, 288, 7734, 309, 261, 4688, 3183, 18, 291, 1921, 10756, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1086, 1435, 288, 3639, 1323, 261, 3767, 13, 288, 5411, 368, 4444, 810, 501, 358, 810, 2389, 5411, 3852, 261, 2377, 13, 288, 7734, 309, 261, 4688, 3183, 18, 291, 1921, 10756, ...
{ return org.tigris.gef.util.Localizer.localize(bundle, key); }
{ return org.tigris.gef.util.Localizer.localize(bundle, key); }
public static String localize(String bundle, String key) { return org.tigris.gef.util.Localizer.localize(bundle, key); }
7166 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/7166/7d618d723423d7f54e532038a97b965f2056183e/Argo.java/clean/src_new/org/argouml/application/api/Argo.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 514, 26407, 12, 780, 3440, 16, 514, 498, 13, 202, 95, 202, 202, 2463, 2358, 18, 88, 2757, 291, 18, 908, 74, 18, 1367, 18, 2042, 1824, 18, 3729, 554, 12, 9991, 16, 498...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 514, 26407, 12, 780, 3440, 16, 514, 498, 13, 202, 95, 202, 202, 2463, 2358, 18, 88, 2757, 291, 18, 908, 74, 18, 1367, 18, 2042, 1824, 18, 3729, 554, 12, 9991, 16, 498...
} else if (buildAllAction != null && found) {
} else if (buildAllAction != null && found && !enabled) {
public void run() { Shell shell = window.getShell(); if (isDisposed || shell == null || shell.isDisposed()) return; IWorkspace workspace = ResourcesPlugin.getWorkspace(); IProject[] projects = workspace.getRoot().getProjects(); boolean enabled = BuildUtilities.isEnabled(projects, IncrementalProjectBuilder.INCREMENTAL_BUILD); //update menu bar actions in project menu buildAllAction.setEnabled(enabled); buildProjectAction.setEnabled(enabled); toggleAutoBuildAction.setChecked(workspace.isAutoBuilding()); cleanAction.setEnabled(BuildUtilities.isEnabled(projects, IncrementalProjectBuilder.CLEAN_BUILD)); //update the cool bar build button ICoolBarManager coolBarManager = actionBarConfigurer .getCoolBarManager(); IContributionItem cbItem = coolBarManager .find(IWorkbenchActionConstants.TOOLBAR_FILE); if (!(cbItem instanceof ToolBarContributionItem)) { // This should not happen IDEWorkbenchPlugin.log("File toolbar contribution item is missing"); //$NON-NLS-1$ return; } ToolBarContributionItem toolBarItem = (ToolBarContributionItem) cbItem; IToolBarManager toolBarManager = toolBarItem.getToolBarManager(); if (toolBarManager == null) { // error if this happens, file toolbar assumed to always exist IDEWorkbenchPlugin.log("File toolbar is missing"); //$NON-NLS-1$ return; } //add the build button if build actions are enabled, and remove it otherwise boolean found = toolBarManager.find(buildAllAction.getId()) != null; if (enabled && !found) { toolBarManager.appendToGroup(IWorkbenchActionConstants.BUILD_GROUP, buildAllAction); toolBarManager.update(false); toolBarItem.update(ICoolBarManager.SIZE); } else if (buildAllAction != null && found) { toolBarManager.remove(buildAllAction.getId()); toolBarManager.update(false); toolBarItem.update(ICoolBarManager.SIZE); } }
58148 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/58148/506669469fa5924c6033fa21a80040a0678d268c/WorkbenchActionBuilder.java/buggy/bundles/org.eclipse.ui.ide/src/org/eclipse/ui/internal/ide/WorkbenchActionBuilder.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 918, 1086, 1435, 288, 7734, 19433, 5972, 273, 2742, 18, 588, 13220, 5621, 7734, 309, 261, 291, 1669, 7423, 747, 5972, 422, 446, 747, 5972, 18, 291, 1669, 7423, 10756, 1171, 202, 24...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 918, 1086, 1435, 288, 7734, 19433, 5972, 273, 2742, 18, 588, 13220, 5621, 7734, 309, 261, 291, 1669, 7423, 747, 5972, 422, 446, 747, 5972, 18, 291, 1669, 7423, 10756, 1171, 202, 24...
PrivateForum pf = prtMsgManager.initializePrivateMessageArea(area);
PrivateForum pf = prtMsgManager.initializePrivateMessageArea(area); pf = prtMsgManager.initializationHelper(pf);
public void initializePrivateMessageArea() { /** get area per request */ area = prtMsgManager.getPrivateMessageArea(); if (getPvtAreaEnabled() || isInstructor()){ PrivateForum pf = prtMsgManager.initializePrivateMessageArea(area); pvtTopics = pf.getTopics(); Collections.sort(pvtTopics, PrivateTopicImpl.TITLE_COMPARATOR); forum=pf; activatePvtMsg = (Boolean.TRUE.equals(area.getEnabled())) ? "yes" : "no"; forwardPvtMsg = (Boolean.TRUE.equals(pf.getAutoForward())) ? "yes" : "no"; forwardPvtMsgEmail = pf.getAutoForwardEmail(); } //add a error message for instructor and private area is not enabled if(isInstructor() && !getPvtAreaEnabled()) { setErrorMessage("The Private Message Area is not turned on for this course. To turn on the Private Message area for this course, click Settings from the Private Message Area bar.") ; } }
48936 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/48936/64a863c65a0bfa0b3ab40fc3e3c7c5c08d053c3f/PrivateMessagesTool.java/clean/messageforums-app/src/java/org/sakaiproject/tool/messageforums/PrivateMessagesTool.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 4046, 6014, 1079, 5484, 1435, 225, 288, 9079, 1783, 336, 5091, 1534, 590, 1195, 565, 5091, 273, 20976, 3332, 1318, 18, 588, 6014, 1079, 5484, 5621, 7734, 309, 261, 588, 27615, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 4046, 6014, 1079, 5484, 1435, 225, 288, 9079, 1783, 336, 5091, 1534, 590, 1195, 565, 5091, 273, 20976, 3332, 1318, 18, 588, 6014, 1079, 5484, 5621, 7734, 309, 261, 588, 27615, ...
add(openComposite);
add(endedComposite);
public void closeOperation(boolean operationOK, boolean addToHistory, int mode) { if (DEBUG_OPERATION_HISTORY_UNEXPECTED) { if (openComposite == null) { System.out .print("OPERATIONHISTORY >>> Attempted to close operation when none was open "); //$NON-NLS-1$ System.out.println(); return; } } if (openComposite != null) { if (DEBUG_OPERATION_HISTORY_OPENOPERATION) { System.out.print("OPERATIONHISTORY >>> Closing operation "); //$NON-NLS-1$ System.out.print(openComposite); System.out.println(); } // any mode other than EXECUTE was triggered by a request to undo or // redo something already in the history, so undo and redo // notification will occur at // the end of that sequence. if (operationOK) { if (mode == EXECUTE) notifyDone(openComposite); if (addToHistory) add(openComposite); } else { if (mode == EXECUTE) notifyNotOK(openComposite); } openComposite = null; } }
57470 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/57470/6ed55bf13812d560205c1b00eb562c4b4f631565/DefaultOperationHistory.java/buggy/bundles/org.eclipse.core.commands/src/org/eclipse/core/commands/operations/DefaultOperationHistory.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 1746, 2988, 12, 6494, 1674, 3141, 16, 1250, 9604, 5623, 16, 1082, 202, 474, 1965, 13, 288, 202, 202, 430, 261, 9394, 67, 22040, 67, 31746, 67, 2124, 27409, 13, 288, 1082,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 1746, 2988, 12, 6494, 1674, 3141, 16, 1250, 9604, 5623, 16, 1082, 202, 474, 1965, 13, 288, 202, 202, 430, 261, 9394, 67, 22040, 67, 31746, 67, 2124, 27409, 13, 288, 1082,...
messageValues[0] = jobInfo.getJob().getName(); messageValues[1] = taskName; messageValues[2] = String.valueOf(getPercentDone());
messageValues[0] = String.valueOf(getPercentDone()); messageValues[1] = jobInfo.getJob().getName(); messageValues[2] = taskName;
String getDisplayString() { if(totalWork == IProgressMonitor.UNKNOWN) return unknownProgress(); if (taskName == null) { return getDisplayStringWithoutTask(); } else { String[] messageValues = new String[3]; messageValues[0] = jobInfo.getJob().getName(); messageValues[1] = taskName; messageValues[2] = String.valueOf(getPercentDone()); return ProgressMessages.format("JobInfo.DoneMessage", messageValues); //$NON-NLS-1$ } }
58148 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/58148/6cd187439cd4cc7af0a6f1e5f6fa64b6a461996c/TaskInfo.java/buggy/bundles/org.eclipse.ui.workbench/Eclipse UI/org/eclipse/ui/internal/progress/TaskInfo.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 780, 13854, 780, 1435, 288, 9506, 202, 430, 12, 4963, 2421, 422, 467, 5491, 7187, 18, 14737, 13, 1082, 202, 2463, 5917, 5491, 5621, 9506, 202, 430, 261, 4146, 461, 422, 446, 13, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 780, 13854, 780, 1435, 288, 9506, 202, 430, 12, 4963, 2421, 422, 467, 5491, 7187, 18, 14737, 13, 1082, 202, 2463, 5917, 5491, 5621, 9506, 202, 430, 261, 4146, 461, 422, 446, 13, 28...
String logFileName = "megameklog.txt"; if (PreferenceManager.getClientPreferences().stampFilenames()) { logFileName = StringUtil.addDateTimeStamp(logFileName); } for (int i = 0; i < args.length; i++) { if (args[i].equals("-testdice")) { TestDice.testDice(); return; } else if (args[i].equals("-dedicated")) { String savegameFileName = null; i++; if (i >= args.length || args[i].startsWith("-")) { i--; } else { savegameFileName = args[i]; }
String logFileName = DEFAULT_LOG_FILE_NAME;
public static void main(String[] args) { int usePort = 2346; String logFileName = "megameklog.txt"; //$NON-NLS-1$ if (PreferenceManager.getClientPreferences().stampFilenames()) { logFileName = StringUtil.addDateTimeStamp(logFileName); } for (int i = 0; i < args.length; i++) { if (args[i].equals("-testdice")) { //$NON-NLS-1$ TestDice.testDice(); return; } else if (args[i].equals("-dedicated")) { //$NON-NLS-1$ // Next argument may be the savegame file's name. String savegameFileName = null; i++; if (i >= args.length || args[i].startsWith("-")) { //$NON-NLS-1$ // no filename -- bump the argument processing back up i--; } else { savegameFileName = args[i]; } // Next argument may be "-port <number>" i++; if (i<args.length) { if (args[i].equals("-port")) { //$NON-NLS-1$ i++; if (i<args.length) { usePort = Integer.decode(args[i]).intValue(); } else { i--; usePort = PreferenceManager.getClientPreferences().getLastServerPort(); } } else { i--; usePort = PreferenceManager.getClientPreferences().getLastServerPort(); } } // kick off a RNG check megamek.common.Compute.d6(); // start server Server dedicated = new Server(PreferenceManager.getClientPreferences().getLastServerPass(), usePort); // load game options from xml file if available dedicated.getGame().getOptions().loadOptions(null); if (null != savegameFileName) { dedicated.loadGame(new File(savegameFileName)); } return; } else if (args[i].equals("-log")) { //$NON-NLS-1$ // Next argument is the log file's name. i++; if (i >= args.length || args[i].equals("none") || args[i].equals("off")) { //$NON-NLS-1$ //$NON-NLS-2$ logFileName = null; } else { logFileName = args[i]; } } else if (args[i].equals("-testxml")) { //$NON-NLS-1$ // Next argument is the log file's name. i++; if (i >= args.length) { System.err.println("The '-testxml' flag requires a file name."); //$NON-NLS-1$ } else { new TinyXMLTest("xml", args[i]); //$NON-NLS-1$ } return; } } // Redirect output to logfiles, unless turned off. if (logFileName != null) { try { System.out.println("Redirecting output to " + logFileName); //$NON-NLS-1$ String sLogDir = PreferenceManager.getClientPreferences().getLogDirectory(); File logDir = new File(sLogDir); if (!logDir.exists()) { logDir.mkdir(); } PrintStream ps = new PrintStream(new BufferedOutputStream(new FileOutputStream(sLogDir + File.separator + logFileName), 64)); System.setOut(ps); System.setErr(ps); } catch (Exception e) { System.err.println("Unable to redirect output to " + logFileName); //$NON-NLS-1$ e.printStackTrace(); } } // End log-to-file new MegaMek(); }
3464 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/3464/15f3f809843b267f4de3e5b3ca28b1e9b8292edb/MegaMek.java/clean/megamek/src/megamek/MegaMek.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 918, 2774, 12, 780, 8526, 833, 13, 288, 3639, 509, 999, 2617, 273, 576, 5026, 26, 31, 3639, 514, 613, 4771, 273, 315, 81, 1332, 339, 79, 1330, 18, 5830, 14432, 4329, 3993, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 918, 2774, 12, 780, 8526, 833, 13, 288, 3639, 509, 999, 2617, 273, 576, 5026, 26, 31, 3639, 514, 613, 4771, 273, 315, 81, 1332, 339, 79, 1330, 18, 5830, 14432, 4329, 3993, ...
98};
98};
protected OMElement createEnvelope() { OMFactory fac = OMAbstractFactory.getOMFactory(); OMNamespace omNs = fac.createOMNamespace("http://localhost/my", "my"); OMElement rpcWrapEle = fac.createOMElement("echoOMElement", omNs); OMElement data = fac.createOMElement("data", omNs); expectedByteArray = new byte[]{13, 56, 65, 32, 12, 12, 7, -3, -2, -1, 98}; for (int i = 0; i < 4; i++) { OMElement subData = fac.createOMElement("subData", omNs); DataHandler dataHandler = new DataHandler("Thilina","text/plain"); //new ByteArrayDataSource(expectedByteArray)); textData = new OMTextImpl(dataHandler, true); subData.addChild(textData); data.addChild(subData); } rpcWrapEle.addChild(data); return rpcWrapEle; }
49300 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/49300/f7e4970b93b85f829dd6abff3c1a80a00ee1ce67/EchoRawMTOMLoadTest.java/clean/modules/integration/test/org/apache/axis2/mtom/EchoRawMTOMLoadTest.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 531, 12310, 752, 10862, 1435, 288, 3639, 28839, 1733, 5853, 273, 531, 5535, 3336, 1733, 18, 588, 1872, 1733, 5621, 3639, 28839, 3402, 8068, 10386, 273, 5853, 18, 2640, 1872, 3402, 293...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 531, 12310, 752, 10862, 1435, 288, 3639, 28839, 1733, 5853, 273, 531, 5535, 3336, 1733, 18, 588, 1872, 1733, 5621, 3639, 28839, 3402, 8068, 10386, 273, 5853, 18, 2640, 1872, 3402, 293...
SendMessageDirectJob j = new SendMessageDirectJob(_context, msg, _block.getRouter(), _priority); _context.jobQueue().addJob(j);
SendMessageDirectJob j = new SendMessageDirectJob(getContext(), msg, _block.getRouter(), _priority); getContext().jobQueue().addJob(j);
protected void send(I2NPMessage msg) { _log.info("Sending reply with " + _message.getClass().getName() + " in a sourceRouteeplyMessage to " + _block.getRouter().toBase64()); SendMessageDirectJob j = new SendMessageDirectJob(_context, msg, _block.getRouter(), _priority); _context.jobQueue().addJob(j); }
45677 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/45677/e737e5c9507ed0d463dc9e45a8f63657f466b177/SendReplyMessageJob.java/clean/router/java/src/net/i2p/router/message/SendReplyMessageJob.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 918, 1366, 12, 45, 22, 23430, 1079, 1234, 13, 288, 3639, 389, 1330, 18, 1376, 2932, 16322, 4332, 598, 315, 397, 389, 2150, 18, 588, 797, 7675, 17994, 1435, 397, 315, 316, 279, 108...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 918, 1366, 12, 45, 22, 23430, 1079, 1234, 13, 288, 3639, 389, 1330, 18, 1376, 2932, 16322, 4332, 598, 315, 397, 389, 2150, 18, 588, 797, 7675, 17994, 1435, 397, 315, 316, 279, 108...
public void testDefaultFailoverMap() throws Exception { { JBossConnectionFactory factory = (JBossConnectionFactory )ic[0].lookup("/ConnectionFactory"); ClusteredClientConnectionFactoryDelegate delegate = (ClusteredClientConnectionFactoryDelegate)factory.getDelegate(); assertEquals(3, ServerManagement.getServer(0).getNodeIDView().size()); ClientConnectionFactoryDelegate[] delegates = delegate.getDelegates(); ClientConnectionFactoryDelegate cf1 = delegate.getDelegates()[0]; ClientConnectionFactoryDelegate cf2 = delegate.getDelegates()[1]; ClientConnectionFactoryDelegate cf3 = delegate.getDelegates()[2]; //The order here depends on the order the servers were started in //If any servers get stopped and then started then the order will change log.info("cf1 serverid=" + cf1.getServerID()); log.info("cf2 serverid=" + cf2.getServerID()); log.info("cf3 serverid=" + cf3.getServerID()); assertEquals(0, cf1.getServerID()); assertEquals(1, cf2.getServerID()); assertEquals(2, cf3.getServerID()); Map failoverMap = delegate.getFailoverMap(); assertEquals(3, delegates.length); assertEquals(3, failoverMap.size()); // Default failover policy just chooses the node to the right assertEquals(cf2.getServerID(), ((Integer)failoverMap.get(new Integer(cf1.getServerID()))).intValue()); assertEquals(cf3.getServerID(), ((Integer)failoverMap.get(new Integer(cf2.getServerID()))).intValue()); assertEquals(cf1.getServerID(), ((Integer)failoverMap.get(new Integer(cf3.getServerID()))).intValue()); } //Now cleanly stop one of the servers log.info("************** STOPPING SERVER 0"); ServerManagement.stop(0); log.info("server stopped"); assertEquals(2, ServerManagement.getServer(1).getNodeIDView().size()); { //Lookup another connection factory JBossConnectionFactory factory = (JBossConnectionFactory )ic[1].lookup("/ConnectionFactory"); log.info("Got connection factory"); ClusteredClientConnectionFactoryDelegate delegate = (ClusteredClientConnectionFactoryDelegate)factory.getDelegate(); ClientConnectionFactoryDelegate[] delegates = delegate.getDelegates(); Map failoverMap = delegate.getFailoverMap(); log.info("Got failover map"); assertEquals(2, delegates.length); ClientConnectionFactoryDelegate cf1 = delegate.getDelegates()[0]; ClientConnectionFactoryDelegate cf2 = delegate.getDelegates()[1]; //Order here depends on order servers were started in log.info("cf1 serverid=" + cf1.getServerID()); log.info("cf2 serverid=" + cf2.getServerID()); assertEquals(1, cf1.getServerID()); assertEquals(2, cf2.getServerID()); assertEquals(2, failoverMap.size()); assertEquals(cf2.getServerID(), ((Integer)failoverMap.get(new Integer(cf1.getServerID()))).intValue()); assertEquals(cf1.getServerID(), ((Integer)failoverMap.get(new Integer(cf2.getServerID()))).intValue()); } //Cleanly stop another server log.info("Server 1 is started: " + ServerManagement.getServer(1).isServerPeerStarted()); ServerManagement.stop(1); assertEquals(1, ServerManagement.getServer(2).getNodeIDView().size()); { //Lookup another connection factory JBossConnectionFactory factory = (JBossConnectionFactory )ic[2].lookup("/ConnectionFactory"); ClusteredClientConnectionFactoryDelegate delegate = (ClusteredClientConnectionFactoryDelegate)factory.getDelegate(); ClientConnectionFactoryDelegate[] delegates = delegate.getDelegates(); Map failoverMap = delegate.getFailoverMap(); assertEquals(1, delegates.length); ClientConnectionFactoryDelegate cf1 = delegate.getDelegates()[0]; assertEquals(2, cf1.getServerID()); assertEquals(1, failoverMap.size()); assertEquals(cf1.getServerID(), ((Integer)failoverMap.get(new Integer(cf1.getServerID()))).intValue()); } //Restart server 0 ServerManagement.start("all", 0); { JBossConnectionFactory factory = (JBossConnectionFactory )ic[0].lookup("/ConnectionFactory"); log.info("Got connection factory"); ClusteredClientConnectionFactoryDelegate delegate = (ClusteredClientConnectionFactoryDelegate)factory.getDelegate(); ClientConnectionFactoryDelegate[] delegates = delegate.getDelegates(); Map failoverMap = delegate.getFailoverMap(); log.info("Got failover map"); assertEquals(2, delegates.length); ClientConnectionFactoryDelegate cf1 = delegate.getDelegates()[0]; ClientConnectionFactoryDelegate cf2 = delegate.getDelegates()[1]; log.info("cf1 serverid=" + cf1.getServerID()); log.info("cf2 serverid=" + cf2.getServerID()); assertEquals(0, cf1.getServerID()); assertEquals(2, cf2.getServerID()); assertEquals(2, failoverMap.size()); assertEquals(cf2.getServerID(), ((Integer)failoverMap.get(new Integer(cf1.getServerID()))).intValue()); assertEquals(cf1.getServerID(), ((Integer)failoverMap.get(new Integer(cf2.getServerID()))).intValue()); } //Restart server 1 ServerManagement.start("all", 1); { JBossConnectionFactory factory = (JBossConnectionFactory )ic[1].lookup("/ConnectionFactory"); log.info("Got connection factory"); ClusteredClientConnectionFactoryDelegate delegate = (ClusteredClientConnectionFactoryDelegate)factory.getDelegate(); ClientConnectionFactoryDelegate[] delegates = delegate.getDelegates(); Map failoverMap = delegate.getFailoverMap(); log.info("Got failover map"); assertEquals(3, delegates.length); ClientConnectionFactoryDelegate cf1 = delegate.getDelegates()[0]; ClientConnectionFactoryDelegate cf2 = delegate.getDelegates()[1]; ClientConnectionFactoryDelegate cf3 = delegate.getDelegates()[2]; log.info("cf1 serverid=" + cf1.getServerID()); log.info("cf2 serverid=" + cf2.getServerID()); log.info("cf3 serverid=" + cf3.getServerID()); assertEquals(0, cf1.getServerID()); assertEquals(1, cf2.getServerID()); assertEquals(2, cf3.getServerID()); assertEquals(3, failoverMap.size()); assertEquals(cf2.getServerID(), ((Integer)failoverMap.get(new Integer(cf1.getServerID()))).intValue()); assertEquals(cf3.getServerID(), ((Integer)failoverMap.get(new Integer(cf2.getServerID()))).intValue()); assertEquals(cf1.getServerID(), ((Integer)failoverMap.get(new Integer(cf3.getServerID()))).intValue()); } }
3806 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/3806/549f137ad1e8828bb44cb18fa8a4e7ce3f825a1e/HATest.java/buggy/tests/src/org/jboss/test/messaging/jms/clustering/HATest.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 565, 1071, 918, 1842, 1868, 26329, 863, 1435, 1216, 1185, 282, 288, 6647, 288, 540, 804, 38, 8464, 18749, 3272, 273, 225, 261, 8877, 8464, 18749, 262, 335, 63, 20, 8009, 8664, 2932, 19, 18749,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 565, 1071, 918, 1842, 1868, 26329, 863, 1435, 1216, 1185, 282, 288, 6647, 288, 540, 804, 38, 8464, 18749, 3272, 273, 225, 261, 8877, 8464, 18749, 262, 335, 63, 20, 8009, 8664, 2932, 19, 18749,...
float[] feature = score.getFeature().getFeatureData();
float[] feature = ((FloatData) score.getData()).getValues();
private void accumulateMean(int senone, TrainerScore score) { if (senone == TrainerAcousticModel.ALL_MODELS) { for (int i = 0; i < senonePool.size(); i++) { accumulateMean(i, score); } } else { GaussianMixture gaussian = (GaussianMixture) senonePool.get(senone); MixtureComponent[] mix = gaussian.getMixtureComponents(); for (int i = 0; i < mix.length; i++) { float[] mean = mix[i].getMean(); // int indexMean = meansPool.indexOf(mean); Integer indexInMap = (Integer) indexMap.get(mean); int indexMean = indexInMap.intValue(); assert indexMean >= 0; assert indexMean == senone; Buffer buffer = (Buffer) meansBufferPool.get(indexMean); float[] feature = score.getFeature().getFeatureData(); double[] data = new double[feature.length]; float prob = score.getComponentGamma()[i]; prob -= currentLogLikelihood; double dprob = logMath.logToLinear(prob); // prob = (float) logMath.logToLinear(prob); for (int j = 0; j < data.length; j++) { data[j] = feature[j] * dprob; } buffer.accumulate(data, dprob); } } }
8321 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/8321/292c05f9235a4c8e014073d071c7352aadfe47de/HMMPoolManager.java/clean/sphinx4/edu/cmu/sphinx/knowledge/acoustic/tiedstate/trainer/HMMPoolManager.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 21757, 15312, 12, 474, 28901, 476, 16, 2197, 14522, 7295, 4462, 13, 288, 202, 430, 261, 87, 275, 476, 422, 2197, 14522, 37, 2894, 641, 335, 1488, 18, 4685, 67, 17391, 55, 13,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 21757, 15312, 12, 474, 28901, 476, 16, 2197, 14522, 7295, 4462, 13, 288, 202, 430, 261, 87, 275, 476, 422, 2197, 14522, 37, 2894, 641, 335, 1488, 18, 4685, 67, 17391, 55, 13,...
DataTracker dataTracker = new DataTracker(db, maxSize, commitSize);
DataTracker newDataTracker = new DataTracker(db, maxSize, commitSize);
public static IntegrationWriterDataTrackingImpl getInstance(Properties props) throws ObjectStoreException { String writerAlias = props.getProperty("osw"); if (writerAlias == null) { throw new ObjectStoreException(props.getProperty("alias") + " does not have an osw" + " alias specified (check properties file)"); } String trackerMaxSizeString = props.getProperty("datatrackerMaxSize"); String trackerCommitSizeString = props.getProperty("datatrackerCommitSize"); if (trackerMaxSizeString == null) { throw new ObjectStoreException(props.getProperty("alias") + " does not have a" + " datatracker maximum size specified (check properties file)"); } if (trackerCommitSizeString == null) { throw new ObjectStoreException(props.getProperty("alias") + " does not have a" + " datatracker commit size specified (check properties file)"); } ObjectStoreWriter writer = ObjectStoreWriterFactory.getObjectStoreWriter(writerAlias); try { int maxSize = Integer.parseInt(trackerMaxSizeString); int commitSize = Integer.parseInt(trackerCommitSizeString); Database db = ((ObjectStoreWriterInterMineImpl) writer).getDatabase(); DataTracker dataTracker = new DataTracker(db, maxSize, commitSize); return new IntegrationWriterDataTrackingImpl(writer, dataTracker); } catch (Exception e) { IllegalArgumentException e2 = new IllegalArgumentException("Problem instantiating" + " IntegrationWriterDataTrackingImpl " + props.getProperty("alias")); e2.initCause(e); throw e2; } }
7196 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/7196/ca277c62d4614d8e9f5486e3abb7e4dffa688a63/IntegrationWriterDataTrackingImpl.java/clean/intermine/src/java/org/intermine/dataloader/IntegrationWriterDataTrackingImpl.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 22936, 2289, 751, 12642, 2828, 3694, 12, 2297, 3458, 13, 5411, 1216, 1033, 21151, 288, 3639, 514, 2633, 2936, 273, 3458, 18, 588, 1396, 2932, 538, 91, 8863, 3639, 309, 261, 629...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 22936, 2289, 751, 12642, 2828, 3694, 12, 2297, 3458, 13, 5411, 1216, 1033, 21151, 288, 3639, 514, 2633, 2936, 273, 3458, 18, 588, 1396, 2932, 538, 91, 8863, 3639, 309, 261, 629...
TypesHelper helper = new TypesHelper(xsdSchema); String aPrefix = helper.getPrefix(element.getAttribute(XSDConstants.TARGETNAMESPACE_ATTRIBUTE), false); if (aPrefix != null && aPrefix.length() > 0) { prefixText.setText(aPrefix); } else
if (element != null)
public void refresh() { if (doRefresh) { // hack...open bug against properties if (prefixText.isDisposed() || targetNamespaceText.isDisposed()) { return; } if (prefixText.isFocusControl() || targetNamespaceText.isFocusControl()) { return; } setListenerEnabled(false); Element element = xsdSchema.getElement(); // Handle prefixText TypesHelper helper = new TypesHelper(xsdSchema); String aPrefix = helper.getPrefix(element.getAttribute(XSDConstants.TARGETNAMESPACE_ATTRIBUTE), false); if (aPrefix != null && aPrefix.length() > 0) { prefixText.setText(aPrefix); } else { prefixText.setText(""); //$NON-NLS-1$ } // Handle TargetNamespaceText String tns = element.getAttribute(XSDConstants.TARGETNAMESPACE_ATTRIBUTE); if (tns != null && tns.length() > 0) { targetNamespaceText.setText(tns); } else { targetNamespaceText.setText(""); //$NON-NLS-1$ } errorText.setText(""); setListenerEnabled(true); } }
13989 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/13989/60a9bf55997bc01dab30b516a1a046ff1ee6469c/NamespaceSection.java/clean/bundles/org.eclipse.wst.xsd.ui/src/org/eclipse/wst/xsd/ui/internal/properties/section/NamespaceSection.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 3196, 202, 482, 918, 4460, 1435, 202, 202, 95, 1377, 309, 261, 2896, 8323, 13, 1377, 288, 3639, 368, 11769, 2777, 3190, 7934, 5314, 1790, 3639, 309, 261, 3239, 1528, 18, 291, 1669, 7423, 1435,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 3196, 202, 482, 918, 4460, 1435, 202, 202, 95, 1377, 309, 261, 2896, 8323, 13, 1377, 288, 3639, 368, 11769, 2777, 3190, 7934, 5314, 1790, 3639, 309, 261, 3239, 1528, 18, 291, 1669, 7423, 1435,...
if (!ensureTargetIsValid(new File(getDestinationValue()))) return false;
if (!ensureTargetIsValid(new File(getDestinationValue()))) { return false; }
public boolean finish() { List resourcesToExport = getWhiteCheckedResources(); if (!ensureTargetIsValid(new File(getDestinationValue()))) return false; //Save dirty editors if possible but do not stop if not all are saved saveDirtyEditors(); // about to invoke the operation so save our state saveWidgetValues(); return executeExportOperation(new FileSystemExportOperation(null, resourcesToExport, getDestinationValue(), this)); }
55805 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/55805/e38d295ea613cf9f08aadb93a84a33d2e91abc5f/WizardFileSystemResourceExportPage1.java/buggy/bundles/org.eclipse.ui.ide/src/org/eclipse/ui/internal/wizards/datatransfer/WizardFileSystemResourceExportPage1.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 1250, 4076, 1435, 288, 3639, 987, 2703, 774, 6144, 273, 336, 13407, 11454, 3805, 5621, 3639, 309, 16051, 15735, 2326, 20536, 12, 2704, 1387, 12, 588, 5683, 620, 1435, 20349, 5411, 327...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 1250, 4076, 1435, 288, 3639, 987, 2703, 774, 6144, 273, 336, 13407, 11454, 3805, 5621, 3639, 309, 16051, 15735, 2326, 20536, 12, 2704, 1387, 12, 588, 5683, 620, 1435, 20349, 5411, 327...
{ String s = getString(columnIndex); DateFormat df = DateFormat.getDateInstance(); if (s != null) { try { java.sql.Date d = (java.sql.Date)df.parse(s); return new Timestamp(d.getTime()); } catch (ParseException e) { throw new SQLException("Bad Timestamp Format: " + s); } } return null; }
{ String s = getString(columnIndex); DateFormat df = DateFormat.getDateInstance(); if (s != null) { try { java.sql.Date d = (java.sql.Date)df.parse(s); return new Timestamp(d.getTime()); } catch (ParseException e) { throw new SQLException("Bad Timestamp Format: " + s); } } return null; }
public Timestamp getTimestamp(int columnIndex) throws SQLException { String s = getString(columnIndex); DateFormat df = DateFormat.getDateInstance(); if (s != null) { try { java.sql.Date d = (java.sql.Date)df.parse(s); return new Timestamp(d.getTime()); } catch (ParseException e) { throw new SQLException("Bad Timestamp Format: " + s); } } return null; // SQL NULL }
45454 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/45454/6a061da272f04e1463864065f87f1f3fd61d6162/ResultSet.java/buggy/src/interfaces/jdbc/postgresql/ResultSet.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 8159, 11940, 12, 474, 14882, 13, 1216, 6483, 202, 95, 202, 202, 780, 272, 273, 4997, 12, 2827, 1016, 1769, 202, 202, 11878, 3013, 273, 18371, 18, 588, 1626, 1442, 5621, 202, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 8159, 11940, 12, 474, 14882, 13, 1216, 6483, 202, 95, 202, 202, 780, 272, 273, 4997, 12, 2827, 1016, 1769, 202, 202, 11878, 3013, 273, 18371, 18, 588, 1626, 1442, 5621, 202, 2...
Vector filterMethods = new Vector(); Class cdClass = getContentDefinitionClass(); try { filterMethods = (Vector)cdClass.getMethod("getFilterMethods", new Class[] { CmsObject.class }).invoke(null, new Object[] { cms }); } catch(InvocationTargetException ite) { if(A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: InvocationTargetException!"); } } catch(NoSuchMethodException nsm) { if(A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: Requested method was not found!"); } } catch(Exception e) { if(A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: Problem occured with your filter methods!"); } } return filterMethods; }
Vector filterMethods = new Vector(); Class cdClass = getContentDefinitionClass(); try { filterMethods = (Vector) cdClass.getMethod("getFilterMethods", new Class[] {CmsObject.class}).invoke(null, new Object[] {cms}); } catch (InvocationTargetException ite) { if (A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: InvocationTargetException!"); } } catch (NoSuchMethodException nsm) { if (A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: Requested method was not found!"); } } catch (Exception e) { if (A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: Problem occured with your filter methods!"); } } return filterMethods; }
private Vector getFilterMethods(CmsObject cms) { Vector filterMethods = new Vector(); Class cdClass = getContentDefinitionClass(); try { filterMethods = (Vector)cdClass.getMethod("getFilterMethods", new Class[] { CmsObject.class }).invoke(null, new Object[] { cms }); } catch(InvocationTargetException ite) { //error occured while applying the filter if(A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: InvocationTargetException!"); } } catch(NoSuchMethodException nsm) { if(A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: Requested method was not found!"); } } catch(Exception e) { if(A_OpenCms.isLogging()) { A_OpenCms.log(C_OPENCMS_INFO, getClassName() + ": Backoffice getContentHead: Problem occured with your filter methods!"); } } return filterMethods; }
51784 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/51784/14d8b5bd357d9dd5036f4099d10dbf7e8c9400a7/A_Backoffice.java/buggy/src/com/opencms/defaults/A_Backoffice.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 5589, 12267, 4712, 12, 4747, 921, 6166, 13, 288, 3639, 5589, 1034, 4712, 273, 394, 5589, 5621, 3639, 1659, 7976, 797, 273, 5154, 1852, 797, 5621, 3639, 775, 288, 5411, 1034, 4712, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 5589, 12267, 4712, 12, 4747, 921, 6166, 13, 288, 3639, 5589, 1034, 4712, 273, 394, 5589, 5621, 3639, 1659, 7976, 797, 273, 5154, 1852, 797, 5621, 3639, 775, 288, 5411, 1034, 4712, 2...
super(params);
if (! compatibility) { set("openid.ns", OPENID2_NS); setClaimed(claimedId); } set("openid.mode", MODE_IDRES); setIdentity(delegate); setReturnTo(returnTo); setNonce(nonce); if (invalidateHandle != null) setInvalidateHandle(invalidateHandle); setHandle(assoc.getHandle()); setSigned(signList); setSignature(assoc.sign(getSignedText()));
public AuthSuccess(ParameterList params) throws MessageException { super(params); }
51216 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/51216/039a03d7f0655e85bd0927b5df9bf1d8ca038941/AuthSuccess.java/buggy/src/net/openid/message/AuthSuccess.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 3123, 4510, 12, 1662, 682, 859, 13, 1216, 2350, 503, 565, 288, 3639, 309, 16051, 8926, 13, 288, 444, 2932, 20619, 18, 2387, 3113, 11919, 734, 22, 67, 3156, 1769, 444, 9762, 329, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 3123, 4510, 12, 1662, 682, 859, 13, 1216, 2350, 503, 565, 288, 3639, 309, 16051, 8926, 13, 288, 444, 2932, 20619, 18, 2387, 3113, 11919, 734, 22, 67, 3156, 1769, 444, 9762, 329, 1...
if (tool.isHeaderFile(ext)) { return true;
try { switch (tool.getNatureFilter()) { case ITool.FILTER_C: if (project.hasNature(CProjectNature.C_NATURE_ID) && !project.hasNature(CCProjectNature.CC_NATURE_ID)) { return tool.isHeaderFile(ext); } break; case ITool.FILTER_CC: if (project.hasNature(CCProjectNature.CC_NATURE_ID)) { return tool.isHeaderFile(ext); } break; case ITool.FILTER_BOTH: return tool.isHeaderFile(ext); } } catch (CoreException e) { continue;
public boolean isHeaderFile(String ext) { // Check to see if there is a rule to build a file with this extension IConfiguration config = getDefaultConfiguration(getDefaultTarget()); ITool[] tools = config.getTools(); for (int index = 0; index < tools.length; index++) { ITool tool = tools[index]; if (tool.isHeaderFile(ext)) { return true; } } return false; }
6192 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/6192/cc6084024dd2af4d5b3c4287f5e9fbae20d84a2a/ManagedBuildInfo.java/buggy/build/org.eclipse.cdt.managedbuilder.core/src/org/eclipse/cdt/managedbuilder/internal/core/ManagedBuildInfo.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 1250, 353, 1864, 812, 12, 780, 1110, 13, 288, 202, 202, 759, 2073, 358, 2621, 309, 1915, 353, 279, 1720, 358, 1361, 279, 585, 598, 333, 2710, 202, 202, 45, 1750, 642, 273, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 1250, 353, 1864, 812, 12, 780, 1110, 13, 288, 202, 202, 759, 2073, 358, 2621, 309, 1915, 353, 279, 1720, 358, 1361, 279, 585, 598, 333, 2710, 202, 202, 45, 1750, 642, 273, 4...
final String methodName = returnCheckSpecification.getMethodName(); final String className = returnCheckSpecification.getClassName();
final String methodName = returnCheckSpecification.getMethodName(); final String className = returnCheckSpecification.getClassName();
private void formatCallCheckString(){ final StringBuffer buffer = new StringBuffer(); synchronized(lock){ boolean first=true; for(ReturnCheckSpecification returnCheckSpecification : callsToCheck){ if(first){ first = false; } else{ buffer.append(','); } final String methodName = returnCheckSpecification.getMethodName(); final String className = returnCheckSpecification.getClassName(); buffer.append(className); buffer.append(','); buffer.append(methodName); } } callCheckString = buffer.toString(); }
56598 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/56598/0c22d3bce35a1ee7d70c329328f649614cf6f21a/IgnoreResultOfCallInspection.java/buggy/plugins/InspectionGadgets/src/com/siyeh/ig/bugs/IgnoreResultOfCallInspection.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 740, 1477, 1564, 780, 1435, 95, 3639, 727, 6674, 1613, 273, 394, 6674, 5621, 3639, 3852, 12, 739, 15329, 5411, 1250, 1122, 33, 3767, 31, 5411, 364, 12, 990, 1564, 8615, 327, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 740, 1477, 1564, 780, 1435, 95, 3639, 727, 6674, 1613, 273, 394, 6674, 5621, 3639, 3852, 12, 739, 15329, 5411, 1250, 1122, 33, 3767, 31, 5411, 364, 12, 990, 1564, 8615, 327, ...
IDEWorkbenchPlugin .log(MessageFormat .format( "Exception in {0}.getNewFolder(): {1}", new Object[] { getClass().getName(), e.getTargetException() }));
IDEWorkbenchPlugin.log(getClass(), "createNewFolder()", e.getTargetException());
public IFolder createNewFolder() { if (newFolder != null) return newFolder; // create the new folder and cache it if successful final IPath containerPath = resourceGroup.getContainerFullPath(); IPath newFolderPath = containerPath.append(resourceGroup.getResource()); final IFolder newFolderHandle = createFolderHandle(newFolderPath); createLinkTarget(); WorkspaceModifyOperation op = new WorkspaceModifyOperation(null) { public void execute(IProgressMonitor monitor) throws CoreException { try { monitor .beginTask( IDEWorkbenchMessages .getString("WizardNewFolderCreationPage.progress"), 2000); //$NON-NLS-1$ ContainerGenerator generator = new ContainerGenerator( containerPath); generator.generateContainer(new SubProgressMonitor(monitor, 1000)); createFolder(newFolderHandle, new SubProgressMonitor( monitor, 1000)); } finally { monitor.done(); } } }; try { getContainer().run(true, true, op); } catch (InterruptedException e) { return null; } catch (InvocationTargetException e) { if (e.getTargetException() instanceof CoreException) { ErrorDialog .openError( getContainer().getShell(), // Was Utilities.getFocusShell() IDEWorkbenchMessages .getString("WizardNewFolderCreationPage.errorTitle"), //$NON-NLS-1$ null, // no special message ((CoreException) e.getTargetException()) .getStatus()); } else { // CoreExceptions are handled above, but unexpected runtime exceptions and errors may still occur. IDEWorkbenchPlugin .log(MessageFormat .format( "Exception in {0}.getNewFolder(): {1}", new Object[] { getClass().getName(), e.getTargetException() }));//$NON-NLS-1$ MessageDialog .openError( getContainer().getShell(), IDEWorkbenchMessages .getString("WizardNewFolderCreationPage.internalErrorTitle"), IDEWorkbenchMessages.format("WizardNewFolder.internalError", new Object[] { e.getTargetException().getMessage() })); //$NON-NLS-2$ //$NON-NLS-1$ } return null; // ie.- one of the steps resulted in a core exception } newFolder = newFolderHandle; return newFolder; }
58148 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/58148/f7c29fb6bdb652f1a858b5e3535c58d788ab85d9/WizardNewFolderMainPage.java/clean/bundles/org.eclipse.ui.ide/extensions/org/eclipse/ui/dialogs/WizardNewFolderMainPage.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 467, 3899, 15291, 3899, 1435, 288, 3639, 309, 261, 2704, 3899, 480, 446, 13, 5411, 327, 394, 3899, 31, 3639, 368, 752, 326, 394, 3009, 471, 1247, 518, 309, 6873, 3639, 727, 467, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 467, 3899, 15291, 3899, 1435, 288, 3639, 309, 261, 2704, 3899, 480, 446, 13, 5411, 327, 394, 3899, 31, 3639, 368, 752, 326, 394, 3009, 471, 1247, 518, 309, 6873, 3639, 727, 467, 7...
eventTypes.add(new Integer(ERROR));
eventTypes.add(ERROR);
public void error (SAXParseException e) throws SAXException { if(buffering) { eventTypes.add(new Integer(ERROR)); eventArguments.add(e); } else if (errorHandler != null) { errorHandler.error(e); } }
1895 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/1895/5bd8136256b7a06c2a8f66363fbe38b5e9e9f206/SAX2BufferImpl.java/buggy/source/org/jasig/portal/utils/SAX2BufferImpl.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 555, 261, 55, 2501, 13047, 425, 13, 1216, 14366, 565, 288, 3639, 309, 12, 4106, 310, 13, 288, 5411, 871, 2016, 18, 1289, 12, 3589, 1769, 5411, 871, 4628, 18, 1289, 12, 73, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 555, 261, 55, 2501, 13047, 425, 13, 1216, 14366, 565, 288, 3639, 309, 12, 4106, 310, 13, 288, 5411, 871, 2016, 18, 1289, 12, 3589, 1769, 5411, 871, 4628, 18, 1289, 12, 73, ...
public void inputChanged(Viewer viewer, Object oldInput, Object newInput) { if(oldInput != null && !oldInput.equals(newInput))
public void inputChanged(Viewer aViewer, Object oldInput, Object newInput) { if (oldInput != null && !oldInput.equals(newInput))
public void inputChanged(Viewer viewer, Object oldInput, Object newInput) { if(oldInput != null && !oldInput.equals(newInput)) rootElements.clear(); }
56152 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/56152/187a6e5e9526ea47a03a969d7ddb741178d2527d/TestContentProvider.java/buggy/tests/org.eclipse.ui.tests.navigator/src/org/eclipse/ui/tests/navigator/extension/TestContentProvider.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 810, 5033, 12, 18415, 14157, 16, 1033, 1592, 1210, 16, 1033, 394, 1210, 13, 288, 3196, 202, 430, 12, 1673, 1210, 480, 446, 597, 401, 1673, 1210, 18, 14963, 12, 2704, 1210...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 810, 5033, 12, 18415, 14157, 16, 1033, 1592, 1210, 16, 1033, 394, 1210, 13, 288, 3196, 202, 430, 12, 1673, 1210, 480, 446, 597, 401, 1673, 1210, 18, 14963, 12, 2704, 1210...
return getRuby().getNil(); }
return getRuby().getNil(); }
public RubyObject m_attr_writer(RubyObject[] args) { for (int i = 0; i < args.length; i++) { addAttribute(((RubySymbol) args[i]).toId(), false, true, true); } return getRuby().getNil(); }
1060 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/1060/0a7181933af700ea8025a4197f3a5ebcc08333c3/RubyModule.java/buggy/org/jruby/RubyModule.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 19817, 921, 312, 67, 1747, 67, 6299, 12, 54, 10340, 921, 8526, 833, 13, 288, 202, 202, 1884, 261, 474, 277, 273, 374, 31, 277, 411, 833, 18, 2469, 31, 277, 27245, 288, 1082,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 19817, 921, 312, 67, 1747, 67, 6299, 12, 54, 10340, 921, 8526, 833, 13, 288, 202, 202, 1884, 261, 474, 277, 273, 374, 31, 277, 411, 833, 18, 2469, 31, 277, 27245, 288, 1082,...
public org.quickfix.field.SymbolSfx getSymbolSfx() throws FieldNotFound { org.quickfix.field.SymbolSfx value = new org.quickfix.field.SymbolSfx();
public quickfix.field.SymbolSfx getSymbolSfx() throws FieldNotFound { quickfix.field.SymbolSfx value = new quickfix.field.SymbolSfx();
public org.quickfix.field.SymbolSfx getSymbolSfx() throws FieldNotFound { org.quickfix.field.SymbolSfx value = new org.quickfix.field.SymbolSfx(); getField(value); return value; }
5926 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/5926/fecc27f98261270772ff182a1d4dfd94b5daa73d/MassQuoteAcknowledgement.java/buggy/src/java/src/quickfix/fix44/MassQuoteAcknowledgement.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 2358, 18, 19525, 904, 18, 1518, 18, 5335, 55, 19595, 18712, 55, 19595, 1435, 1216, 2286, 2768, 225, 288, 2358, 18, 19525, 904, 18, 1518, 18, 5335, 55, 19595, 460, 273, 394, 2358, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 2358, 18, 19525, 904, 18, 1518, 18, 5335, 55, 19595, 18712, 55, 19595, 1435, 1216, 2286, 2768, 225, 288, 2358, 18, 19525, 904, 18, 1518, 18, 5335, 55, 19595, 460, 273, 394, 2358, ...
String flag = req.readAtom();
String flag = req.readATOM();
private boolean executeRequest(ImapRequest req, ImapSession session) throws IOException, ImapException { if (session != null && session.isIdle()) return doIDLE(null, IDLE_STOP, req.readAtom().equals("DONE") && req.eof()); String tag = req.readTag(); boolean byUID = false; req.skipSpace(); String command = mLastCommand = req.readAtom(); do { switch (command.charAt(0)) { case 'A': if (command.equals("AUTHENTICATE")) { req.skipSpace(); String mechanism = req.readAtom(); byte[] response = null; if (req.peekChar() == ' ') { req.skipSpace(); response = req.readBase64(true); } checkEOF(tag, req); return doAUTHENTICATE(tag, mechanism, response); } else if (command.equals("APPEND")) { List<String> flags = null; Date date = null; req.skipSpace(); String folder = req.readFolder(); req.skipSpace(); if (req.peekChar() == '(') { flags = req.readFlags(); req.skipSpace(); } if (req.peekChar() == '"') { date = req.readDate(mTimeFormat); req.skipSpace(); } if (req.peekChar() == 'c' || req.peekChar() == 'C') { List<Object> parts = new LinkedList<Object>(); req.skipAtom("CATENATE"); req.skipSpace(); req.skipChar('('); while (req.peekChar() != ')') { if (!parts.isEmpty()) req.skipSpace(); String type = req.readAtom(); req.skipSpace(); if (type.equals("TEXT")) parts.add(req.readLiteral()); else if (type.equals("URL")) parts.add(new ImapURL(tag, mSession, req.readAstring())); else throw new ImapParseException(tag, "unknown CATENATE cat-part: " + type); } req.skipChar(')'); checkEOF(tag, req); return doCATENATE(tag, folder, flags, date, parts); } else { byte[] content = req.readLiteral8(); checkEOF(tag, req); return doAPPEND(tag, folder, flags, date, content); } } break; case 'C': if (command.equals("CAPABILITY")) { checkEOF(tag, req); return doCAPABILITY(tag); } else if (command.equals("COPY")) { req.skipSpace(); String sequence = req.readSequence(); req.skipSpace(); String folder = req.readFolder(); checkEOF(tag, req); return doCOPY(tag, sequence, folder, byUID); } else if (command.equals("CLOSE")) { checkEOF(tag, req); return doCLOSE(tag); } else if (command.equals("CREATE")) { req.skipSpace(); String folder = req.readFolder(); checkEOF(tag, req); return doCREATE(tag, folder); } else if (command.equals("CHECK")) { checkEOF(tag, req); return doCHECK(tag); } break; case 'D': if (command.equals("DELETE")) { req.skipSpace(); String folder = req.readFolder(); checkEOF(tag, req); return doDELETE(tag, folder); } break; case 'E': if (command.equals("EXPUNGE")) { String sequence = null; if (byUID) { req.skipSpace(); sequence = req.readSequence(); } checkEOF(tag, req); return doEXPUNGE(tag, byUID, sequence); } else if (command.equals("EXAMINE")) { req.skipSpace(); String folder = req.readFolder(); checkEOF(tag, req); return doEXAMINE(tag, folder); } break; case 'F': if (command.equals("FETCH")) { List<ImapPartSpecifier> parts = new ArrayList<ImapPartSpecifier>(); req.skipSpace(); String sequence = req.readSequence(); req.skipSpace(); int attributes = req.readFetch(parts); checkEOF(tag, req); return doFETCH(tag, sequence, attributes, parts, byUID); } break; case 'G': if (command.equals("GETQUOTA")) { req.skipSpace(); String qroot = req.readAstring(); checkEOF(tag, req); return doGETQUOTA(tag, qroot); } else if (command.equals("GETQUOTAROOT")) { req.skipSpace(); String path = req.readFolder(); checkEOF(tag, req); return doGETQUOTAROOT(tag, path); } break; case 'I': if (command.equals("ID")) { req.skipSpace(); Map<String, String> params = req.readParameters(true); checkEOF(tag, req); return doID(tag, params); } else if (command.equals("IDLE")) { checkEOF(tag, req); return doIDLE(tag, IDLE_START, true); } break; case 'L': if (command.equals("LOGIN")) { req.skipSpace(); String user = req.readAstring(); req.skipSpace(); String pass = req.readAstring(); checkEOF(tag, req); return doLOGIN(tag, user, pass); } else if (command.equals("LOGOUT")) { checkEOF(tag, req); return doLOGOUT(tag); } else if (command.equals("LIST")) { req.skipSpace(); String base = req.readEscapedFolder(); req.skipSpace(); String pattern = req.readFolderPattern(); checkEOF(tag, req); return doLIST(tag, base, pattern); } else if (command.equals("LSUB")) { req.skipSpace(); String base = req.readEscapedFolder(); req.skipSpace(); String pattern = req.readFolderPattern(); checkEOF(tag, req); return doLSUB(tag, base, pattern); } break; case 'N': if (command.equals("NOOP")) { checkEOF(tag, req); return doNOOP(tag); } else if (command.equals("NAMESPACE")) { checkEOF(tag, req); return doNAMESPACE(tag); } break; case 'R': if (command.equals("RENAME")) { req.skipSpace(); String folder = req.readFolder(); req.skipSpace(); String name = req.readFolder(); checkEOF(tag, req); return doRENAME(tag, folder, name); } break; case 'S': if (command.equals("STORE")) { byte operation = STORE_REPLACE; boolean silent = false; req.skipSpace(); String sequence = req.readSequence(); req.skipSpace(); switch (req.peekChar()) { case '+': req.skipChar('+'); operation = STORE_ADD; break; case '-': req.skipChar('-'); operation = STORE_REMOVE; break; } String cmd = req.readAtom(); if (cmd.equals("FLAGS.SILENT")) silent = true; else if (!cmd.equals("FLAGS")) throw new ImapParseException(tag, "invalid store-att-flags"); req.skipSpace(); List<String> flags = req.readFlags(); checkEOF(tag, req); return doSTORE(tag, sequence, flags, operation, silent, byUID); } else if (command.equals("SEARCH")) { Integer options = null; TreeMap<Integer, Object> insertions = new TreeMap<Integer, Object>(); req.skipSpace(); if ("RETURN".equals(req.peekAtom())) { options = 0; req.skipAtom("RETURN"); req.skipSpace(); req.skipChar('('); while (req.peekChar() != ')') { if (options != 0) req.skipSpace(); String option = req.readAtom(); if (option.equals("MIN")) options |= RETURN_MIN; else if (option.equals("MAX")) options |= RETURN_MAX; else if (option.equals("ALL")) options |= RETURN_ALL; else if (option.equals("COUNT")) options |= RETURN_COUNT; else if (option.equals("SAVE")) options |= RETURN_SAVE; else throw new ImapParseException(tag, "unknown RETURN option \"" + option + '"'); } req.skipChar(')'); req.skipSpace(); if (options == 0) options = RETURN_ALL; } String search = req.readSearch(insertions); checkEOF(tag, req); return doSEARCH(tag, search, insertions, byUID, options); } else if (command.equals("SELECT")) { req.skipSpace(); String folder = req.readFolder(); checkEOF(tag, req); return doSELECT(tag, folder); } else if (command.equals("STARTTLS")) { checkEOF(tag, req); return doSTARTTLS(tag); } else if (command.equals("STATUS")) { int status = 0; req.skipSpace(); String folder = req.readFolder(); req.skipSpace(); req.skipChar('('); while (req.peekChar() != ')') { if (status != 0) req.skipSpace(); String flag = req.readAtom(); if (flag.equals("MESSAGES")) status |= STATUS_MESSAGES; else if (flag.equals("RECENT")) status |= STATUS_RECENT; else if (flag.equals("UIDNEXT")) status |= STATUS_UIDNEXT; else if (flag.equals("UIDVALIDITY")) status |= STATUS_UIDVALIDITY; else if (flag.equals("UNSEEN")) status |= STATUS_UNSEEN; else throw new ImapParseException(tag, "unknown STATUS attribute \"" + flag + '"'); } req.skipChar(')'); checkEOF(tag, req); return doSTATUS(tag, folder, status); } else if (command.equals("SUBSCRIBE")) { req.skipSpace(); String folder = req.readFolder(); checkEOF(tag, req); return doSUBSCRIBE(tag, folder); } else if (command.equals("SETQUOTA")) { Map<String, String> limits = new HashMap<String, String>(); req.skipSpace(); String qroot = req.readAstring(); req.skipSpace(); req.skipChar('('); while (req.peekChar() != ')') { String resource = req.readAtom(); req.skipSpace(); limits.put(resource, req.readNumber()); } req.skipChar(')'); checkEOF(tag, req); return doSETQUOTA(tag, qroot, limits); } break; case 'U': if (command.equals("UID")) { req.skipSpace(); command = req.readAtom(); if (!command.equals("FETCH") && !command.equals("SEARCH") && !command.equals("COPY") && !command.equals("STORE") && !command.equals("EXPUNGE")) throw new ImapParseException(tag, "command not permitted with UID"); byUID = true; continue; } else if (command.equals("UNSUBSCRIBE")) { req.skipSpace(); String folder = req.readFolder(); checkEOF(tag, req); return doUNSUBSCRIBE(tag, folder); } else if (command.equals("UNSELECT")) { checkEOF(tag, req); return doUNSELECT(tag); } break; } } while (byUID); throw new ImapParseException(tag, "command not implemented"); }
6965 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/6965/c0e5cc9943be1b3fd0220b5c4ee7f7259d1454e0/ImapHandler.java/clean/ZimbraServer/src/java/com/zimbra/cs/imap/ImapHandler.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 1250, 1836, 691, 12, 20827, 691, 1111, 16, 467, 1458, 2157, 1339, 13, 1216, 1860, 16, 467, 1458, 503, 288, 3639, 309, 261, 3184, 480, 446, 597, 1339, 18, 291, 13834, 10756, 5411, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 1250, 1836, 691, 12, 20827, 691, 1111, 16, 467, 1458, 2157, 1339, 13, 1216, 1860, 16, 467, 1458, 503, 288, 3639, 309, 261, 3184, 480, 446, 597, 1339, 18, 291, 13834, 10756, 5411, ...
throw ExceptionFactory.makeMessageException(Messages.getMessage("MethodNotImplemented", "MessageImpl.getAsSOAPMessage()"));
try { OMElement element = xmlPart.getAsOMElement(); ByteArrayOutputStream outStream = new ByteArrayOutputStream(); element.serialize(outStream); ByteArrayInputStream inStream = new ByteArrayInputStream(outStream .toByteArray()); MessageFactory mf = MessageFactory.newInstance(); MimeHeaders defaultHeader = new MimeHeaders(); defaultHeader.addHeader("Content-type", "text/xml; charset=UTF-8"); SOAPMessage soapMessage = mf.createMessage(defaultHeader, inStream); return soapMessage; } catch (Exception e) { throw ExceptionFactory.makeMessageException(e); }
public SOAPMessage getAsSOAPMessage() throws MessageException { // TODO Missing implementation throw ExceptionFactory.makeMessageException(Messages.getMessage("MethodNotImplemented", "MessageImpl.getAsSOAPMessage()")); }
49300 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/49300/036a12e3edc92b5f14a8982bfa9b60a3318021e5/MessageImpl.java/buggy/modules/jaxws/src/org/apache/axis2/jaxws/message/impl/MessageImpl.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 16434, 1079, 13122, 27952, 1079, 1435, 1216, 2350, 503, 288, 202, 202, 759, 2660, 10230, 4471, 202, 202, 12849, 1185, 1733, 18, 6540, 31270, 12, 5058, 18, 24906, 2932, 1305, 1248,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 16434, 1079, 13122, 27952, 1079, 1435, 1216, 2350, 503, 288, 202, 202, 759, 2660, 10230, 4471, 202, 202, 12849, 1185, 1733, 18, 6540, 31270, 12, 5058, 18, 24906, 2932, 1305, 1248,...
_uri = argument(0); if (_uri instanceof LiteralExpr) { LiteralExpr expr = (LiteralExpr)_uri; if (expr.getValue().equals(EMPTYSTRING)) { Stylesheet stylesheet = getStylesheet(); if (stylesheet == null) { ErrorMsg msg = new ErrorMsg(ErrorMsg.ILLEGAL_ARG_ERR, this); throw new TypeCheckError(msg); } _uri = new LiteralExpr(stylesheet.getSystemId(), EMPTYSTRING); } }
_arg1 = argument(0);
public Type typeCheck(SymbolTable stable) throws TypeCheckError { // At least one argument - two at most final int ac = argumentCount(); if ((ac < 1) || (ac > 2)) { ErrorMsg msg = new ErrorMsg(ErrorMsg.ILLEGAL_ARG_ERR, this); throw new TypeCheckError(msg); } // Parse the first argument - the document URI _uri = argument(0); if (_uri instanceof LiteralExpr) { LiteralExpr expr = (LiteralExpr)_uri; if (expr.getValue().equals(EMPTYSTRING)) { Stylesheet stylesheet = getStylesheet(); if (stylesheet == null) { ErrorMsg msg = new ErrorMsg(ErrorMsg.ILLEGAL_ARG_ERR, this); throw new TypeCheckError(msg); } _uri = new LiteralExpr(stylesheet.getSystemId(), EMPTYSTRING); } } _uriType = _uri.typeCheck(stable); if ((_uriType != Type.NodeSet) && (_uriType != Type.String)) { _uri = new CastExpr(_uri, Type.String); } // Parse the second argument - the document URI base if (ac == 2) { _base = argument(1); final Type baseType = _base.typeCheck(stable); if (baseType.identicalTo(Type.Node)) { _base = new CastExpr(_base, Type.NodeSet); } else if (baseType.identicalTo(Type.NodeSet)) { // falls through } else { ErrorMsg msg = new ErrorMsg(ErrorMsg.DOCUMENT_ARG_ERR, this); throw new TypeCheckError(msg); } } return _type = Type.NodeSet; }
46591 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/46591/90690d28d7a287fb496550daf58cc79f422d8099/DocumentCall.java/clean/src/org/apache/xalan/xsltc/compiler/DocumentCall.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 1412, 618, 1564, 12, 5335, 1388, 14114, 13, 1216, 1412, 1564, 668, 288, 202, 759, 2380, 4520, 1245, 1237, 300, 2795, 622, 4486, 202, 6385, 509, 1721, 273, 1237, 1380, 5621, 202, 430...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 1412, 618, 1564, 12, 5335, 1388, 14114, 13, 1216, 1412, 1564, 668, 288, 202, 759, 2380, 4520, 1245, 1237, 300, 2795, 622, 4486, 202, 6385, 509, 1721, 273, 1237, 1380, 5621, 202, 430...
jj_la1[28] = jj_gen;
jj_la1[27] = jj_gen;
final public void VariableDeclaratorId() throws ParseException { /*@bgen(jjtree) VariableDeclaratorId */ ASTVariableDeclaratorId jjtn000 = new ASTVariableDeclaratorId(this, JJTVARIABLEDECLARATORID); boolean jjtc000 = true; jjtree.openNodeScope(jjtn000);String s = null; Token t = null; try { t = jj_consume_token(IDENTIFIER); s = t.image; label_12: while (true) { switch ((jj_ntk==-1)?jj_ntk():jj_ntk) { case LBRACKET: ; break; default: jj_la1[28] = jj_gen; break label_12; } jj_consume_token(LBRACKET); jj_consume_token(RBRACKET); } jjtree.closeNodeScope(jjtn000, true); jjtc000 = false; jjtn000.setImage( s ); } finally { if (jjtc000) { jjtree.closeNodeScope(jjtn000, true); } } }
45569 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/45569/e4e1467181b67cfd9bbbd764d319d740024b0993/JavaParser.java/buggy/pmd/src/net/sourceforge/pmd/ast/JavaParser.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 727, 1071, 918, 7110, 31419, 548, 1435, 1216, 10616, 288, 1748, 36, 70, 4507, 12, 78, 78, 3413, 13, 7110, 31419, 548, 1195, 225, 9183, 3092, 31419, 548, 10684, 5088, 3784, 273, 394, 9183,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 727, 1071, 918, 7110, 31419, 548, 1435, 1216, 10616, 288, 1748, 36, 70, 4507, 12, 78, 78, 3413, 13, 7110, 31419, 548, 1195, 225, 9183, 3092, 31419, 548, 10684, 5088, 3784, 273, 394, 9183,...
try { position++; bCodeStream[classFileOffset++] = OPC_invokespecial; } catch (IndexOutOfBoundsException e) { resizeByteArray(OPC_invokespecial);
if (classFileOffset + 2 >= bCodeStream.length) { resizeByteArray();
public void invokeNoClassDefFoundErrorStringConstructor() { // invokespecial: java.lang.NoClassDefFoundError.<init>(Ljava.lang.String;)V if (DEBUG) System.out.println(position + "\t\tinvokespecial: java.lang.NoClassDefFoundError.<init>(Ljava.lang.String;)V"); //$NON-NLS-1$ countLabels = 0; try { position++; bCodeStream[classFileOffset++] = OPC_invokespecial; } catch (IndexOutOfBoundsException e) { resizeByteArray(OPC_invokespecial); } writeUnsignedShort(constantPool.literalIndexForJavaLangNoClassDefFoundErrorStringConstructor()); stackDepth -= 2;}
10698 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/10698/3a562aaf09f9f323b583086b80b4683378886606/CodeStream.java/buggy/org.eclipse.jdt.core/compiler/org/eclipse/jdt/internal/compiler/codegen/CodeStream.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 1071, 918, 4356, 2279, 797, 3262, 2043, 668, 780, 6293, 1435, 288, 202, 759, 18058, 705, 649, 30, 2252, 18, 4936, 18, 2279, 797, 3262, 2043, 668, 22782, 2738, 34, 12, 21159, 18, 4936, 18, 78...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 1071, 918, 4356, 2279, 797, 3262, 2043, 668, 780, 6293, 1435, 288, 202, 759, 18058, 705, 649, 30, 2252, 18, 4936, 18, 2279, 797, 3262, 2043, 668, 22782, 2738, 34, 12, 21159, 18, 4936, 18, 78...
if (rubyClass.getSuperClass().getRealClass() != superClass) { return false;
if (superClass != null) { if (rubyClass.getSuperClass().getRealClass() != superClass) { return false; }
private boolean matchingClassExists(String className, RubyClass superClass) { if (! isConstantDefined(className)) { return false; } IRubyObject type = getConstant(className); if (! (type instanceof RubyClass)) { throw new TypeError(runtime, className + " is not a class"); } RubyClass rubyClass = (RubyClass) type; if (rubyClass.getSuperClass().getRealClass() != superClass) { return false; } if (runtime.getSafeLevel() >= 4) { throw new SecurityError(runtime, "extending class prohibited"); } return true; }
50661 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/50661/fe00c45012a36b20ff7faeacd9acb6883e4b0af1/EvaluateVisitor.java/clean/src/org/jruby/evaluator/EvaluateVisitor.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 1250, 3607, 797, 4002, 12, 780, 2658, 16, 19817, 797, 18846, 13, 288, 3639, 309, 16051, 353, 6902, 8116, 12, 12434, 3719, 288, 5411, 327, 629, 31, 3639, 289, 3639, 15908, 10340, 921...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 1250, 3607, 797, 4002, 12, 780, 2658, 16, 19817, 797, 18846, 13, 288, 3639, 309, 16051, 353, 6902, 8116, 12, 12434, 3719, 288, 5411, 327, 629, 31, 3639, 289, 3639, 15908, 10340, 921...
private DnDAction getDnDActionForPlatformAction(int platformAction) {
private static DnDAction getDnDActionForPlatformAction(int platformAction) {
private DnDAction getDnDActionForPlatformAction(int platformAction) { DnDAction action = null; switch (platformAction) { case DnDConstants.ACTION_COPY : action = DnDAction.ADD; break; case DnDConstants.ACTION_MOVE : action = DnDAction.MOVE; break; case DnDConstants.ACTION_LINK: action = DnDAction.BIND; break; default: break; } return action; }
12814 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/12814/aeb687a5339fb81ab4009be6dbac22d02f4bd915/DnDManagerImpl.java/clean/source/com/intellij/ide/dnd/DnDManagerImpl.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 3238, 760, 463, 82, 40, 1803, 2343, 82, 40, 1803, 1290, 8201, 1803, 12, 474, 4072, 1803, 13, 288, 565, 463, 82, 40, 1803, 1301, 273, 446, 31, 565, 1620, 261, 9898, 1803, 13, 288, 1377...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 3238, 760, 463, 82, 40, 1803, 2343, 82, 40, 1803, 1290, 8201, 1803, 12, 474, 4072, 1803, 13, 288, 565, 463, 82, 40, 1803, 1301, 273, 446, 31, 565, 1620, 261, 9898, 1803, 13, 288, 1377...
insertTextDocumentImages( textDocument, user );
insertTextDocumentImages( textDocument );
void updateTextDocumentImages( TextDocumentDomainObject textDocument, UserDomainObject user ) { deleteTextDocumentImages( textDocument ); insertTextDocumentImages( textDocument, user ); }
8781 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/8781/3b0fe7c2d4b2d004a5a425682d8a6461277e633a/DocumentStoringVisitor.java/buggy/server/src/imcode/server/document/DocumentStoringVisitor.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 918, 1089, 1528, 2519, 8946, 12, 3867, 2519, 3748, 921, 977, 2519, 16, 2177, 3748, 921, 729, 262, 288, 3639, 1430, 1528, 2519, 8946, 12, 977, 2519, 11272, 3639, 2243, 1528, 2519, 8946, 12...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 918, 1089, 1528, 2519, 8946, 12, 3867, 2519, 3748, 921, 977, 2519, 16, 2177, 3748, 921, 729, 262, 288, 3639, 1430, 1528, 2519, 8946, 12, 977, 2519, 11272, 3639, 2243, 1528, 2519, 8946, 12...
ByteArrayOutputStream bos = new ByteArrayOutputStream ();
ByteArrayOutputStream bos = new ByteArrayOutputStream();
public boolean next () throws IOException { if (eof) return false; // read header header = new Hashtable (); String line; while (true) { line = readLine (); if (line == null || line.equals ("")) break; int cut = line.indexOf (':'); if (cut == -1) throw new IOException ("colon missing in multipart header line: "+line); header.put (line.substring (0, cut).trim ().toLowerCase (), line.substring (cut+1).trim ()); System.out.println ("key: '"+line.substring (0, cut).trim ().toLowerCase () + "' value: '" + line.substring (cut+1).trim ()); } System.out.println ("cte-head: "+ getHeader ("Content-Transfer-Encoding")); String contentType = getHeader ("Content-Type"); if ("base64".equals (getHeader ("Content-Transfer-Encoding"))) { ByteArrayOutputStream bos = new ByteArrayOutputStream (); while (true) { line = readLine (); if (line == null) throw new IOException ("Unexpected EOF"); if (line.startsWith (boundary)) break; Base64.decode (line, bos); } data = bos.toByteArray (); } else { ByteArrayOutputStream bos = new ByteArrayOutputStream (); String deli = "\r\n" + boundary; int match = 0; while (true) { int i = is.read (); if (i >= 32 && i <= 127) System.out.print ((char) i); else System.out.print ("#"+i+";"); if (i == -1) throw new RuntimeException ("Unexpected EOF"); if (((char) i) == deli.charAt (match)) { match++; if (match == deli.length ()) break; } else { if (match > 0) { for (int j = 0; j < match; j++) bos.write ((byte) deli.charAt (j)); match = ((char) i == deli.charAt (0)) ? 1 : 0; } bos.write ((byte) i); } } data = bos.toByteArray (); line = readLine (); // read crlf and possibly remaining -- } if (line.endsWith ("--")) eof = true; return true; }
4841 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/4841/cce2b605c6b4e455bee4bf39b7ca197f897bfbfa/Decoder.java/clean/src/org/kobjects/mime/Decoder.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 1250, 1024, 1832, 1216, 1860, 288, 3639, 309, 261, 9339, 13, 327, 629, 31, 202, 759, 855, 1446, 225, 202, 3374, 273, 394, 18559, 261, 1769, 3639, 514, 980, 31, 202, 17523, 261, 37...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 1250, 1024, 1832, 1216, 1860, 288, 3639, 309, 261, 9339, 13, 327, 629, 31, 202, 759, 855, 1446, 225, 202, 3374, 273, 394, 18559, 261, 1769, 3639, 514, 980, 31, 202, 17523, 261, 37...
de = ( CompositeSequence ) compositeSequenceDao.create( de ); ad.getCompositeSequences().add( de );
reporter = ( Reporter ) reporterDao.create( reporter ); ad.getReporters().add( reporter ); CompositeSequence compositeSequence = CompositeSequence.Factory.newInstance(); if ( randomNames ) { compositeSequence.setName( RandomStringUtils.randomNumeric( RANDOM_STRING_LENGTH ) + "_test" ); } else { compositeSequence.setName( "probe_" + i ); } compositeSequence.getComponentReporters().add( reporter ); compositeSequence = ( CompositeSequence ) compositeSequenceDao.create( compositeSequence ); ad.getCompositeSequences().add( compositeSequence );
protected ArrayDesign getTestPersistentArrayDesign( int numCompositeSequences, boolean randomNames ) { ArrayDesign ad = ArrayDesign.Factory.newInstance(); ad.setName( RandomStringUtils.randomAlphabetic( RANDOM_STRING_LENGTH ) ); for ( int i = 0; i < numCompositeSequences; i++ ) { CompositeSequence de = CompositeSequence.Factory.newInstance(); if ( randomNames ) { de.setName( RandomStringUtils.randomNumeric( RANDOM_STRING_LENGTH ) + "_test" ); } else { de.setName( i + "_at" ); } de = ( CompositeSequence ) compositeSequenceDao.create( de ); ad.getCompositeSequences().add( de ); } // use service to get acl ArrayDesignService arrayDesignService = ( ArrayDesignService ) this.getBean( "arrayDesignService" ); ad = arrayDesignService.create( ad ); for ( CompositeSequence cs : ad.getCompositeSequences() ) { cs.setArrayDesign( ad ); } flushSession(); return ad; }
4335 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/4335/1222b5051b43c0b81d63144bfc6770b731b19db7/BaseTransactionalSpringContextTest.java/clean/gemma-testing/src/main/java/ubic/gemma/testing/BaseTransactionalSpringContextTest.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 1510, 15478, 29384, 11906, 1076, 15478, 12, 509, 818, 9400, 21710, 16, 1250, 2744, 1557, 262, 288, 3639, 1510, 15478, 1261, 273, 1510, 15478, 18, 1733, 18, 2704, 1442, 5621, 3639, 126...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 1510, 15478, 29384, 11906, 1076, 15478, 12, 509, 818, 9400, 21710, 16, 1250, 2744, 1557, 262, 288, 3639, 1510, 15478, 1261, 273, 1510, 15478, 18, 1733, 18, 2704, 1442, 5621, 3639, 126...
public PatternDescr lhs_or() throws RecognitionException { PatternDescr d; PatternDescr left = null; PatternDescr right = null; d = null; try { // /home/michael/projects/jboss-rules/drools-compiler/src/main/resources/org/drools/lang/drl.g:891:17: (left= lhs_and ( ('or'|'||') opt_eol right= lhs_and )* ) // /home/michael/projects/jboss-rules/drools-compiler/src/main/resources/org/drools/lang/drl.g:891:17: left= lhs_and ( ('or'|'||') opt_eol right= lhs_and )* { OrDescr or = null; following.push(FOLLOW_lhs_and_in_lhs_or2453); left=lhs_and(); following.pop(); d = left; // /home/michael/projects/jboss-rules/drools-compiler/src/main/resources/org/drools/lang/drl.g:893:17: ( ('or'|'||') opt_eol right= lhs_and )* loop58: do { int alt58=2; int LA58_0 = input.LA(1); if ( (LA58_0>=41 && LA58_0<=42) ) { alt58=1; } switch (alt58) { case 1 : // /home/michael/projects/jboss-rules/drools-compiler/src/main/resources/org/drools/lang/drl.g:893:19: ('or'|'||') opt_eol right= lhs_and { if ( (input.LA(1)>=41 && input.LA(1)<=42) ) { input.consume(); errorRecovery=false; } else { MismatchedSetException mse = new MismatchedSetException(null,input); recoverFromMismatchedSet(input,mse,FOLLOW_set_in_lhs_or2462); throw mse; } following.push(FOLLOW_opt_eol_in_lhs_or2467); opt_eol(); following.pop(); following.push(FOLLOW_lhs_and_in_lhs_or2474); right=lhs_and(); following.pop(); if ( or == null ) { or = new OrDescr(); or.addDescr( left ); d = or; } or.addDescr( right ); } break; default : break loop58; } } while (true); } } catch (RecognitionException re) { reportError(re); recover(input,re); } finally { } return d; }
5490 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/5490/cb210a30853642e270a3bba6ce570409f6046852/RuleParser.java/buggy/drools-compiler/src/main/java/org/drools/lang/RuleParser.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 6830, 16198, 8499, 67, 280, 1435, 1216, 9539, 288, 6647, 6830, 16198, 302, 31, 3639, 6830, 16198, 2002, 273, 446, 31, 3639, 6830, 16198, 2145, 273, 446, 31, 540, 202, 202, 72, 273, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 6830, 16198, 8499, 67, 280, 1435, 1216, 9539, 288, 6647, 6830, 16198, 302, 31, 3639, 6830, 16198, 2002, 273, 446, 31, 3639, 6830, 16198, 2145, 273, 446, 31, 540, 202, 202, 72, 273, ...
if (fSkipValidationDepth >= 0) return; int count = fMatcherStack.getMatcherCount(); for (int i = 0; i < count; i++) { XPathMatcher matcher = fMatcherStack.getMatcherAt(i); matcher.characters(text); }
public void ignorableWhitespace(XMLString text) throws XNIException { // call handlers if (fDocumentHandler != null) { fDocumentHandler.ignorableWhitespace(text); } if (fSkipValidationDepth >= 0) return; // call all active identity constraints int count = fMatcherStack.getMatcherCount(); for (int i = 0; i < count; i++) { XPathMatcher matcher = fMatcherStack.getMatcherAt(i); matcher.characters(text); } } // ignorableWhitespace(XMLString)
6373 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/6373/eeb7517c4cc4197def51b4bc9aa28ba7210e59dd/XMLSchemaValidator.java/buggy/src/org/apache/xerces/impl/xs/XMLSchemaValidator.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 9750, 15514, 9431, 12, 4201, 780, 977, 13, 1216, 1139, 50, 45, 503, 288, 3639, 368, 745, 4919, 3639, 309, 261, 74, 2519, 1503, 480, 446, 13, 288, 5411, 284, 2519, 1503, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 9750, 15514, 9431, 12, 4201, 780, 977, 13, 1216, 1139, 50, 45, 503, 288, 3639, 368, 745, 4919, 3639, 309, 261, 74, 2519, 1503, 480, 446, 13, 288, 5411, 284, 2519, 1503, 18, ...
msg.set(NODE_TO_NODE_MESSAGE_DATA, data);
msg.set(NODE_TO_NODE_MESSAGE_DATA, new ShortBuffer(data));
public static final Message createNodeToNodeMessage(int type, String data) { Message msg = new Message(nodeToNodeTextMessage); msg.set(NODE_TO_NODE_MESSAGE_TYPE, type); msg.set(NODE_TO_NODE_MESSAGE_DATA, data); return msg; }
50619 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/50619/ad0bf740a058caf02fdf4de184f13067e0275d43/DMT.java/clean/src/freenet/io/comm/DMT.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 727, 2350, 24584, 31403, 1079, 12, 474, 618, 16, 514, 501, 13, 288, 202, 202, 1079, 1234, 273, 394, 2350, 12, 2159, 31403, 1528, 1079, 1769, 202, 202, 3576, 18, 542, 12, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 727, 2350, 24584, 31403, 1079, 12, 474, 618, 16, 514, 501, 13, 288, 202, 202, 1079, 1234, 273, 394, 2350, 12, 2159, 31403, 1528, 1079, 1769, 202, 202, 3576, 18, 542, 12, ...
if ((sx1 > width1) || (sx2 < 0) ||
if ((sx1 > width1) || (sx2 < 0) ||
protected void flat_image(PImage image, int sx1, int sy1) { int ix1 = 0; int iy1 = 0; int ix2 = image.width; int iy2 = image.height; if (image_mode == CENTER) { sx1 -= image.width / 2; sy1 -= image.height / 2; } int sx2 = sx1 + image.width; int sy2 = sy1 + image.height; // don't draw if completely offscreen // (without this check, ArrayIndexOutOfBoundsException) if ((sx1 > width1) || (sx2 < 0) || (sy1 > height1) || (sy2 < 0)) return; if (sx1 < 0) { // off left edge ix1 -= sx1; sx1 = 0; } if (sy1 < 0) { // off top edge iy1 -= sy1; sy1 = 0; } if (sx2 > width) { // off right edge ix2 -= sx2 - width; sx2 = width; } if (sy2 > height) { // off bottom edge iy2 -= sy2 - height; sy2 = height; } int source = iy1 * image.width + ix1; int target = sy1 * width; if (image.format == RGBA) { for (int y = sy1; y < sy2; y++) { int tx = 0; for (int x = sx1; x < sx2; x++) { pixels[target + x] = _blend(pixels[target + x], image.pixels[source + tx], image.pixels[source + tx++] >>> 24); } source += image.width; target += width; } } else if (image.format == ALPHA) { for (int y = sy1; y < sy2; y++) { int tx = 0; for (int x = sx1; x < sx2; x++) { pixels[target + x] = _blend(pixels[target + x], fill, image.pixels[source + tx++]); } source += image.width; target += width; } } else if (image.format == RGB) { target += sx1; int tw = sx2 - sx1; for (int y = sy1; y < sy2; y++) { System.arraycopy(image.pixels, source, pixels, target, tw); // should set z coordinate in here // or maybe not, since dims=0, meaning no relevant z source += image.width; target += width; } } }
8833 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/8833/d877999f6e97d3c619ae60b800d586ac00acf618/PGraphics.java/clean/core/PGraphics.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 4750, 918, 3569, 67, 2730, 12, 1102, 81, 410, 1316, 16, 509, 13280, 21, 16, 509, 1393, 21, 13, 288, 565, 509, 8288, 21, 273, 374, 31, 565, 509, 23466, 21, 273, 374, 31, 565, 509, 82...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 4750, 918, 3569, 67, 2730, 12, 1102, 81, 410, 1316, 16, 509, 13280, 21, 16, 509, 1393, 21, 13, 288, 565, 509, 8288, 21, 273, 374, 31, 565, 509, 23466, 21, 273, 374, 31, 565, 509, 82...
eDynamicUnset( eFeature );
super.eUnset( featureID );
public void eUnset( EStructuralFeature eFeature ) { switch ( eDerivedStructuralFeatureID( eFeature ) ) { case AttributePackage.EMBEDDED_IMAGE__TYPE : unsetType( ); return; case AttributePackage.EMBEDDED_IMAGE__URL : setURL( URL_EDEFAULT ); return; case AttributePackage.EMBEDDED_IMAGE__DATA : setData( DATA_EDEFAULT ); return; } eDynamicUnset( eFeature ); }
12803 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/12803/036e8c78765730b146e5854b9d6c397a296fed86/EmbeddedImageImpl.java/clean/chart/org.eclipse.birt.chart.engine/src/org/eclipse/birt/chart/model/attribute/impl/EmbeddedImageImpl.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 19698, 12, 512, 14372, 4595, 425, 4595, 262, 202, 95, 202, 202, 9610, 261, 425, 21007, 14372, 4595, 734, 12, 425, 4595, 262, 262, 202, 202, 95, 1082, 202, 3593, 3601, 226...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 19698, 12, 512, 14372, 4595, 425, 4595, 262, 202, 95, 202, 202, 9610, 261, 425, 21007, 14372, 4595, 734, 12, 425, 4595, 262, 262, 202, 202, 95, 1082, 202, 3593, 3601, 226...
buf.append(className);
buf.append(sourceFile);
public String format(String key) { if (key.equals("")) { StringBuffer buf = new StringBuffer(); buf.append(className); buf.append(":["); if (startLine == endLine) { buf.append("line "); buf.append(startLine); } else { buf.append("lines "); buf.append(startLine); buf.append('-'); buf.append(endLine); } buf.append(']'); return buf.toString(); } else throw new IllegalStateException("Unknown format key " + key); }
7352 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/7352/26d4f6af88d660e3e41bd1837217176c038dba87/SourceLineAnnotation.java/buggy/findbugs/src/java/edu/umd/cs/findbugs/SourceLineAnnotation.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 514, 740, 12, 780, 498, 13, 288, 202, 202, 430, 261, 856, 18, 14963, 2932, 6, 3719, 288, 1082, 202, 780, 1892, 1681, 273, 394, 6674, 5621, 1082, 202, 4385, 18, 6923, 12, 124...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 514, 740, 12, 780, 498, 13, 288, 202, 202, 430, 261, 856, 18, 14963, 2932, 6, 3719, 288, 1082, 202, 780, 1892, 1681, 273, 394, 6674, 5621, 1082, 202, 4385, 18, 6923, 12, 124...
methodClass.defineMethod("arity", arity); methodClass.defineMethod("[]", call); methodClass.defineMethod("call", call);
methodClass.defineMethod("arity", arity); methodClass.defineMethod("[]", call); methodClass.defineMethod("call", call);
public static RubyClass createMethodClass(Ruby ruby) { RubyCallbackMethod arity = new ReflectionCallbackMethod(RubyMethod.class, "arity"); RubyCallbackMethod call = new ReflectionCallbackMethod(RubyMethod.class, "call", true); RubyClass methodClass = ruby.defineClass("Method", ruby.getClasses().getObjectClass()); methodClass.defineMethod("arity", arity); methodClass.defineMethod("[]", call); methodClass.defineMethod("call", call); return methodClass; }
1060 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/1060/0a7181933af700ea8025a4197f3a5ebcc08333c3/RubyMethod.java/buggy/org/jruby/RubyMethod.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 19817, 797, 752, 1305, 797, 12, 54, 10340, 22155, 13, 288, 202, 202, 54, 10340, 2428, 1305, 19353, 273, 1082, 202, 2704, 5685, 2428, 1305, 12, 54, 10340, 1305, 18, 1106, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 19817, 797, 752, 1305, 797, 12, 54, 10340, 22155, 13, 288, 202, 202, 54, 10340, 2428, 1305, 19353, 273, 1082, 202, 2704, 5685, 2428, 1305, 12, 54, 10340, 1305, 18, 1106, ...
JavassistUtils.resolve( new Class[]{Method.class, Object.class, Object[].class} ), ctClass );
JavassistUtils.resolve( new Class[]{ Method.class, Object.class, Object[].class } ), ctClass );
private static Class createInvocationClass( ClassLoader classLoader, Method interfaceMethod ) throws CannotCompileException { Class invocationClass; final CtClass ctClass = JavassistUtils.createClass( getSimpleName( interfaceMethod.getDeclaringClass() ) + "_" + interfaceMethod.getName() + "_invocation", JavassistInvocation.class ); final CtConstructor constructor = new CtConstructor( JavassistUtils.resolve( new Class[]{Method.class, Object.class, Object[].class} ), ctClass ); constructor.setBody( "{\n\tsuper($$);\n}" ); ctClass.addConstructor( constructor ); final CtMethod proceedMethod = new CtMethod( JavassistUtils.resolve( Object.class ), "proceed", JavassistUtils.resolve( new Class[0] ), ctClass ); final Class[] argumentTypes = interfaceMethod.getParameterTypes(); final StringBuffer proceedBody = new StringBuffer( "{\n" ); if( !Void.TYPE.equals( interfaceMethod.getReturnType() ) ) { proceedBody.append( "\treturn " ); } else { proceedBody.append( "\t" ); } proceedBody.append( "( (" ); proceedBody.append( ProxyUtils.getJavaClassName( interfaceMethod.getDeclaringClass() ) ); proceedBody.append( " )target )." ); proceedBody.append( interfaceMethod.getName() ); proceedBody.append( "(" ); for( int i = 0; i < argumentTypes.length; ++i ) { proceedBody.append( "(" ); proceedBody.append( ProxyUtils.getJavaClassName( argumentTypes[i] ) ); proceedBody.append( ")arguments[" ); proceedBody.append( i ); proceedBody.append( "]" ); if( i != argumentTypes.length - 1 ) { proceedBody.append( ", " ); } } proceedBody.append( ");\n" ); if( Void.TYPE.equals( interfaceMethod.getReturnType() ) ) { proceedBody.append( "\treturn null;\n" ); } proceedBody.append( "}" ); proceedMethod.setBody( proceedBody.toString() ); ctClass.addMethod( proceedMethod ); invocationClass = ctClass.toClass( classLoader ); return invocationClass; }
51801 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/51801/75e082134851dcb68c682f420405550d7f057522/JavassistInvocation.java/clean/src/java/org/apache/commons/proxy/factory/javassist/JavassistInvocation.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 760, 1659, 752, 9267, 797, 12, 9403, 11138, 16, 2985, 1560, 1305, 262, 5411, 1216, 14143, 9937, 503, 565, 288, 3639, 1659, 9495, 797, 31, 3639, 727, 30714, 797, 5691, 797, 273, 804,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 760, 1659, 752, 9267, 797, 12, 9403, 11138, 16, 2985, 1560, 1305, 262, 5411, 1216, 14143, 9937, 503, 565, 288, 3639, 1659, 9495, 797, 31, 3639, 727, 30714, 797, 5691, 797, 273, 804,...
public void drawLine (int x1, int y1, int x2, int y2)
public void drawLine(int x1, int y1, int x2, int y2)
public void drawLine (int x1, int y1, int x2, int y2) { int xp[] = new int[2]; int yp[] = new int[2]; xp[0] = x1; xp[1] = x2; yp[0] = y1; yp[1] = y2; doPolygon (xp, yp, 2, false, false); }
47947 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/47947/b23a69766b998a4a095a0e59631aa072d973a7fe/GdkGraphics2D.java/clean/gnu/java/awt/peer/gtk/GdkGraphics2D.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 30732, 12, 474, 619, 21, 16, 509, 677, 21, 16, 509, 619, 22, 16, 509, 677, 22, 13, 225, 288, 565, 509, 13681, 8526, 273, 394, 509, 63, 22, 15533, 565, 509, 29647, 8526, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 30732, 12, 474, 619, 21, 16, 509, 677, 21, 16, 509, 619, 22, 16, 509, 677, 22, 13, 225, 288, 565, 509, 13681, 8526, 273, 394, 509, 63, 22, 15533, 565, 509, 29647, 8526, 2...
getBody().run(context, output);
invokeBody(output);
public void doTag(XMLOutput output) throws Exception { // force project to be lazily constructed getProject().setDefaultGoalName( this.defaultGoalName ); org.apache.tools.ant.Project antProject = AntTagLibrary.getProject( context ); // allow access to Ant methods via the project class context.setVariable( "project", antProject ); getBody().run(context, output); }
51800 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/51800/0d5aec147baa5b0b5399591c7e9dd775bb22bcb4/ProjectTag.java/clean/src/java/org/apache/commons/jelly/tags/werkz/ProjectTag.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 741, 1805, 12, 4201, 1447, 876, 13, 1216, 1185, 288, 9079, 368, 2944, 1984, 358, 506, 25047, 15688, 7734, 11080, 7675, 542, 1868, 27716, 461, 12, 333, 18, 1886, 27716, 461, 112...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 741, 1805, 12, 4201, 1447, 876, 13, 1216, 1185, 288, 9079, 368, 2944, 1984, 358, 506, 25047, 15688, 7734, 11080, 7675, 542, 1868, 27716, 461, 12, 333, 18, 1886, 27716, 461, 112...
private TextSpanLayout getOffsetAdjustedTextLayout( AttributedCharacterIterator aci, FontRenderContext frc) { TextSpanLayout layout = getTextLayoutFactory().createTextLayout(aci, new Point2D.Float(0f, 0f), new java.awt.font.FontRenderContext( new AffineTransform(), true, true)); TextNode.Anchor anchor = (TextNode.Anchor) aci.getAttribute( GVTAttributedCharacterIterator.TextAttribute.ANCHOR_TYPE); int anchorType = TextNode.Anchor.ANCHOR_START; if (anchor != null) anchorType = anchor.getType(); Point2D advance = layout.getAdvance2D(); float dx = 0f; float dy = 0f; switch(anchorType){ case TextNode.Anchor.ANCHOR_MIDDLE: dx = (float) (-advance.getX()/2d); dy = (float) (-advance.getY()/2d); break; case TextNode.Anchor.ANCHOR_END: dx = (float) (-advance.getX()); dy = (float) (-advance.getY()); break; default: // leave untouched } Point2D offset = layout.getOffset(); if (layout.isVertical()) { layout.setOffset(new Point2D.Float( (float) offset.getX(), (float) offset.getY()+dy)); } else { layout.setOffset(new Point2D.Float( (float) offset.getX()+dx, (float) offset.getY())); } return layout; }
45946 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/45946/722077ac2ba94a100164f684d159431c68c5e607/BasicTextPainter.java/buggy/sources/org/apache/batik/gvt/renderer/BasicTextPainter.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 3867, 6952, 3744, 13386, 10952, 329, 1528, 3744, 12, 5397, 2380, 11050, 7069, 3198, 1721, 77, 16, 10063, 3420, 1042, 284, 1310, 13, 288, 3639, 3867, 6952, 3744, 3511, 273, 6701, 3744,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 3867, 6952, 3744, 13386, 10952, 329, 1528, 3744, 12, 5397, 2380, 11050, 7069, 3198, 1721, 77, 16, 10063, 3420, 1042, 284, 1310, 13, 288, 3639, 3867, 6952, 3744, 3511, 273, 6701, 3744,...
Context context = checkContext();
Context context = getContext();
private void removeBindingInternal(String name, boolean serviceBinding) { try { if (name == null) { throw new NullPointerException("The name must not be null"); } Context context = checkContext(); try { context.removeBinding(getInternalName(name, serviceBinding)); } catch (NameNotBoundException e) { throw new NameNotBoundException( "Name '" + name + "' is not bound"); } if (logger.isLoggable(Level.FINEST)) { logger.log( Level.FINEST, "{0} name:{1} returns", serviceBinding ? "removeServiceBinding" : "removeBinding", name); } } catch (RuntimeException e) { if (logger.isLoggable(Level.FINEST)) { logger.logThrow( Level.FINEST, "{0} name:{1} throws", e, serviceBinding ? "removeServiceBinding" : "removeBinding", name); } throw e; } }
48631 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/48631/51014428559746a71eea60ff89c4bc5babf778c1/DataServiceImpl.java/clean/src/server/j2se/com/sun/sgs/impl/service/data/DataServiceImpl.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 1206, 5250, 3061, 12, 780, 508, 16, 1250, 1156, 5250, 13, 288, 202, 698, 288, 202, 565, 309, 261, 529, 422, 446, 13, 288, 202, 202, 12849, 394, 10108, 2932, 1986, 508, 1297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 1206, 5250, 3061, 12, 780, 508, 16, 1250, 1156, 5250, 13, 288, 202, 698, 288, 202, 565, 309, 261, 529, 422, 446, 13, 288, 202, 202, 12849, 394, 10108, 2932, 1986, 508, 1297, ...
protected void initSettings() { IDialogSettings settings = getDialogSettings(); if (settings.get(SETTINGS_SAVED) == null) { // Set default values taskListCheckBox.setSelection(true); taskActivationHistoryCheckBox.setSelection(true); taskContextsCheckBox.setSelection(true); sourceDirText.setText(""); overwriteCheckBox.setSelection(true); importFromFolderGroup.setEnabled(true); importViaFolderButton.setSelection(true); } else { // Retrieve previous values from the dialog settings taskListCheckBox.setSelection(settings.getBoolean(TASKLIST_SETTING)); taskActivationHistoryCheckBox.setSelection(settings.getBoolean(ACTIVATION_HISTORY_SETTING)); taskContextsCheckBox.setSelection(settings.getBoolean(CONTEXTS_SETTING)); importViaFolderButton.setSelection(settings.getBoolean(IMPORT_METHOD_SETTING)); importViaZipButton.setSelection(!importViaFolderButton.getSelection()); importFromFolderGroup.setEnabled(importViaFolderButton.getSelection()); importFromZipGroup.setEnabled(importViaZipButton.getSelection()); browseButton.setEnabled(importFromFolderGroup.isEnabled()); browseButtonZip.setEnabled(importFromZipGroup.isEnabled()); String directory = settings.get(SOURCE_DIR_SETTING); if (directory != null) { sourceDirText.setText(settings.get(SOURCE_DIR_SETTING)); } String zipFile = settings.get(SOURCE_ZIP_SETTING); if (zipFile != null) { sourceZipText.setText(settings.get(SOURCE_ZIP_SETTING)); } overwriteCheckBox.setSelection(settings.getBoolean(OVERWRITE_SETTING)); } }
51151 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/51151/30c86c135cbd0421b86b3df78f8f1e01efff1b79/TaskDataImportWizardPage.java/clean/org.eclipse.mylyn.tasks.ui/src/org/eclipse/mylyn/internal/tasklist/ui/wizards/TaskDataImportWizardPage.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 918, 1208, 2628, 1435, 288, 202, 202, 734, 3529, 2628, 1947, 273, 31774, 2628, 5621, 202, 202, 430, 261, 4272, 18, 588, 12, 19428, 67, 5233, 12135, 13, 422, 446, 13, 288, 108...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 918, 1208, 2628, 1435, 288, 202, 202, 734, 3529, 2628, 1947, 273, 31774, 2628, 5621, 202, 202, 430, 261, 4272, 18, 588, 12, 19428, 67, 5233, 12135, 13, 422, 446, 13, 288, 108...
MIR_Load.setOffset(inst, IC(frameSize - offset - 256));
if ( frameIsRequired()) MIR_Load.setOffset(inst, IC(frameSize - offset - 256)); else MIR_Load.setOffset(inst, IC(-offset - 256));
void cleanUpAndInsertEpilogue() { OPT_PhysicalRegisterSet phys = ir.regpool.getPhysicalRegisterSet(); OPT_Instruction inst = ir.firstInstructionInCodeOrder().nextInstructionInCodeOrder(); for (; inst != null; inst = inst.nextInstructionInCodeOrder()) { switch (inst.getOpcode()) { case PPC_MOVE_opcode: case PPC_FMR_opcode: // remove frivolous moves if (MIR_Move.getResult(inst).register.number == MIR_Move.getValue(inst).register.number) inst = inst.remove(); break; case PPC_BLR_opcode: if (frameIsRequired()) insertEpilogue(inst); break; case PPC_LFS_opcode: case PPC_LFD_opcode: case PPC_LInt_opcode: case PPC_LWZ_opcode: case PPC_LAddr_opcode: // the following to handle spilled parameters // SJF: this is ugly. clean it up someday. if (MIR_Load.getAddress(inst).register == ir.regpool.getPhysicalRegisterSet().getFP()) { OPT_Operand one = MIR_Load.getOffset(inst); if (one instanceof OPT_IntConstantOperand) { int offset = ((OPT_IntConstantOperand) one).value; if (offset <= -256) { MIR_Load.setOffset(inst, IC(frameSize - offset - 256)); } } } default: break; } } }
5245 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/5245/e91a0c0d12128840b0bc19690813b65cca3ae137/OPT_StackManager.java/clean/rvm/src/vm/arch/powerPC/compilers/optimizing/regalloc/OPT_StackManager.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 918, 26384, 1876, 4600, 18918, 21947, 344, 1435, 288, 565, 16456, 67, 18136, 3996, 694, 24758, 273, 9482, 18, 1574, 6011, 18, 588, 18136, 3996, 694, 5621, 565, 16456, 67, 11983, 1804, 273, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 918, 26384, 1876, 4600, 18918, 21947, 344, 1435, 288, 565, 16456, 67, 18136, 3996, 694, 24758, 273, 9482, 18, 1574, 6011, 18, 588, 18136, 3996, 694, 5621, 565, 16456, 67, 11983, 1804, 273, ...
if (piece.isBlack)
if (!piece.isBlack)
protected void unexecute () { if (Log.debug) { Log.debug(DEBUG, "unexecuting move: " + this); Log.debug2(DEBUG, board); } board.setEnPassantFile(prevEnPassantFile); //castling if (piece.isKing() && piece.moveCount == 1) { Square rook_orig, rook_dest; //long if (dest.file == 3) { //c-file rook_orig = board.getSquare(1,orig.rank); //a-file rook_dest = board.getSquare(4,orig.rank); //d-file rook_orig.piece = rook_dest.piece; rook_dest.piece = null; rook_orig.piece.orig = rook_orig; rook_orig.piece.moveCount--; } //short else if (dest.file == 7) { //g-file rook_orig = board.getSquare(8,orig.rank); //h-file rook_dest = board.getSquare(6,orig.rank); //f-file rook_orig.piece = rook_dest.piece; rook_dest.piece = null; rook_orig.piece.orig = rook_orig; rook_orig.piece.moveCount--; } } //pawn promotion (use same function to reverse the promotion) if (piece.isPawn() && Pawn.isPromotionSquare(dest, piece.isBlack)) { board.promote(promotion, piece); } dest.piece.moveCount--; orig.piece = dest.piece; piece.orig = orig; dest.piece = null; if (casualty != null) { casualty.setCaptured(false); casualty.orig.piece = casualty; //put piece on board } //50MoveRule if (piece.isPawn() || casualty != null) board.plyCount50 = prevPlyCount50; else board.plyCount50--; //set board to alternate who moves flag board.isBlackMove = piece.isBlack; board.lastMove = (ChessMove) prev; //move number if (piece.isBlack) board.moveNumber--; executed = false; board.staleLegalDests = true; //broadcast changes in the model board.fireBoardEvent(BoardEvent.UNMOVE); if (Log.debug) { Log.debug(DEBUG, "unexecute successful"); Log.debug2(DEBUG, board); } }
2285 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/2285/e2ef29e2c8c8581ae7e41e5d7b4c9e143cce251b/ChessMove.java/clean/ictk/src/ictk/boardgame/chess/ChessMove.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 565, 4750, 918, 640, 8837, 1832, 288, 540, 309, 261, 1343, 18, 4148, 13, 288, 202, 565, 1827, 18, 4148, 12, 9394, 16, 315, 318, 4177, 8490, 3635, 30, 315, 397, 333, 1769, 202, 565, 1827, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 565, 4750, 918, 640, 8837, 1832, 288, 540, 309, 261, 1343, 18, 4148, 13, 288, 202, 565, 1827, 18, 4148, 12, 9394, 16, 315, 318, 4177, 8490, 3635, 30, 315, 397, 333, 1769, 202, 565, 1827, 1...
public void init(int i) { add(new Beamform(i, numChannels)); add(new BeamFirFilter(mfSize, numPostDec2, 1)); add(new Magnitude()); add(new Detector(i, numPostDec2, targetBeam, targetSamplePostDec, cfarThreshold)); }
public void init() { add(new Beamform(i+k, numChannels)); add(new BeamFirFilter(mfSize, numPostDec2, 1)); add(new Magnitude()); add(new Detector(i+k, numPostDec2, targetBeam, targetSamplePostDec, cfarThreshold)); }
public void init(int i) { add(new Beamform(i, numChannels)); // Need to replace this fir with //fft -> elWiseMult -> ifft add(new BeamFirFilter(mfSize, numPostDec2, 1)); add(new Magnitude()); // with a more sophisticated detector, we need // someplace to store the data until we can find // the targets... add(new Detector(i, numPostDec2, targetBeam, targetSamplePostDec, cfarThreshold)); }
47772 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/47772/bac6e051d071e3af9abc59969a0fa4eb9e188670/BeamFormer.java/buggy/streams/apps/benchmarks/beamformer/streamit/BeamFormer.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 1875, 202, 482, 918, 1208, 12, 474, 277, 13, 288, 9506, 225, 527, 12, 2704, 605, 3820, 687, 12, 77, 16, 9944, 282, 818, 10585, 10019, 9506, 225, 368, 12324, 358, 1453, 333, 284, 481, 598, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 1875, 202, 482, 918, 1208, 12, 474, 277, 13, 288, 9506, 225, 527, 12, 2704, 605, 3820, 687, 12, 77, 16, 9944, 282, 818, 10585, 10019, 9506, 225, 368, 12324, 358, 1453, 333, 284, 481, 598, ...
List hints = new ArrayList();
List<String> hints = new ArrayList<String>();
protected List getHints() { List hints = new ArrayList(); hints.add( "There are no hints defined." ); return hints; }
47703 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/47703/e5b3b00b0f724a9834bcadb34453e906f7c0d25b/LessonAdapter.java/buggy/ webgoat/main/project/JavaSource/org/owasp/webgoat/lessons/LessonAdapter.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 987, 336, 13368, 1435, 202, 95, 202, 202, 682, 13442, 273, 394, 2407, 5621, 202, 202, 24598, 18, 1289, 12, 315, 9828, 854, 1158, 13442, 2553, 1199, 11272, 202, 202, 2463, 13442...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 1117, 987, 336, 13368, 1435, 202, 95, 202, 202, 682, 13442, 273, 394, 2407, 5621, 202, 202, 24598, 18, 1289, 12, 315, 9828, 854, 1158, 13442, 2553, 1199, 11272, 202, 202, 2463, 13442...
if ( bMinSliceDefined && bMinSliceApplied )
if ( bMinSliceApplied )
public final Size compute( IDisplayServer xs, Chart cm, SeriesDefinition[] seda, RunTimeContext rtc ) throws ChartException { // THREE CASES: // 1. ALL SERIES IN ONE ARRAYLIST // 2. ONE SERIES PER ARRAYLIST // 3. ALL OTHERS Legend lg = cm.getLegend( ); if ( !lg.isSetOrientation( ) ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, "exception.legend.orientation.horzvert", //$NON-NLS-1$ ResourceBundle.getBundle( Messages.ENGINE, xs.getLocale( ) ) ); } if ( !lg.isSetDirection( ) ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, "exception.legend.direction.tblr", //$NON-NLS-1$ ResourceBundle.getBundle( Messages.ENGINE, xs.getLocale( ) ) ); } // INITIALIZATION OF VARS USED IN FOLLOWING LOOPS Orientation orientation = lg.getOrientation( ); Direction direction = lg.getDirection( ); double maxWrappingSize = lg.getWrappingSize( ); Label la = LabelImpl.create( ); la.setCaption( (Text) EcoreUtil.copy( lg.getText( ) ) ); ClientArea ca = lg.getClientArea( ); LineAttributes lia = ca.getOutline( ); double dSeparatorThickness = lia.getThickness( ); double dWidth = 0, dHeight = 0; la.getCaption( ).setValue( "X" ); //$NON-NLS-1$ final ITextMetrics itm = xs.getTextMetrics( la ); double dItemHeight = itm.getFullHeight( ); Series se; ArrayList al; double dScale = xs.getDpiResolution( ) / 72d; Insets insCA = ca.getInsets( ).scaledInstance( dScale ); final boolean bPaletteByCategory = ( cm.getLegend( ) .getItemType( ) .getValue( ) == LegendItemType.CATEGORIES ); Series seBase; // Get available maximum block width/height. Block bl = cm.getBlock( ); Bounds boFull = bl.getBounds( ).scaledInstance( dScale ); Insets ins = bl.getInsets( ).scaledInstance( dScale ); Insets lgIns = lg.getInsets( ).scaledInstance( dScale ); double dAvailableWidth = boFull.getWidth( ) - ins.getLeft( ) - ins.getRight( ) - lgIns.getLeft( ) - lgIns.getRight( ); double dAvailableHeight = boFull.getHeight( ) - ins.getTop( ) - ins.getBottom( ) - lgIns.getTop( ) - lgIns.getBottom( ) - cm.getTitle( ) .getBounds( ) .scaledInstance( dScale ) .getHeight( ); // Calculate if minSlice applicable. boolean bMinSliceDefined = false; double dMinSlice = 0; boolean bPercentageMinSlice = false; String sMinSliceLabel = null; boolean bMinSliceApplied = false; if ( cm instanceof ChartWithoutAxes ) { bMinSliceDefined = ( (ChartWithoutAxes) cm ).isSetMinSlice( ); dMinSlice = ( (ChartWithoutAxes) cm ).getMinSlice( ); bPercentageMinSlice = ( (ChartWithoutAxes) cm ).isMinSlicePercent( ); sMinSliceLabel = ( (ChartWithoutAxes) cm ).getMinSliceLabel( ); if ( sMinSliceLabel == null || sMinSliceLabel.length( ) == 0 ) { sMinSliceLabel = IConstants.UNDEFINED_STRING; } else { sMinSliceLabel = rtc.externalizedMessage( sMinSliceLabel ); } } // calculate if need an extra legend item when minSlice defined. if ( bMinSliceDefined && bPaletteByCategory && cm instanceof ChartWithoutAxes ) { if ( !( (ChartWithoutAxes) cm ).getSeriesDefinitions( ).isEmpty( ) ) { // OK TO ASSUME THAT 1 BASE SERIES DEFINITION EXISTS SeriesDefinition sdBase = (SeriesDefinition) ( (ChartWithoutAxes) cm ).getSeriesDefinitions( ) .get( 0 ); SeriesDefinition[] sdOrtho = (SeriesDefinition[]) sdBase.getSeriesDefinitions( ) .toArray( ); DataSetIterator dsiOrtho = null; double dCurrentMinSlice = 0; for ( int i = 0; i < sdOrtho.length && !bMinSliceApplied; i++ ) { try { dsiOrtho = new DataSetIterator( ( (Series) sdOrtho[i].getRunTimeSeries( ) .get( 0 ) ).getDataSet( ) ); } catch ( Exception ex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.RENDERING, ex ); } // TODO Check dataSet type, throw exception or ignore?. if ( bPercentageMinSlice ) { double total = 0; while ( dsiOrtho.hasNext( ) ) { Object obj = dsiOrtho.next( ); if ( obj instanceof Number ) { total += ( (Number) obj ).doubleValue( ); } } dsiOrtho.reset( ); dCurrentMinSlice = total * dMinSlice / 100d; } else { dCurrentMinSlice = dMinSlice; } while ( dsiOrtho.hasNext( ) ) { Object obj = dsiOrtho.next( ); if ( obj instanceof Number ) { double val = ( (Number) obj ).doubleValue( ); if ( val < dCurrentMinSlice ) { bMinSliceApplied = true; break; } } } } } } // COMPUTATIONS HERE MUST BE IN SYNC WITH THE ACTUAL RENDERER if ( orientation.getValue( ) == Orientation.VERTICAL ) { double dW, dMaxW = 0; double dFullHeight = 0, dExtraWidth = 0, dDeltaHeight; if ( bPaletteByCategory ) { SeriesDefinition sdBase = null; if ( cm instanceof ChartWithAxes ) { final Axis axPrimaryBase = ( (ChartWithAxes) cm ).getBaseAxes( )[0]; // ONLY // SUPPORT // 1 // BASE // AXIS // FOR // NOW if ( axPrimaryBase.getSeriesDefinitions( ).isEmpty( ) ) { return SizeImpl.create( 0, 0 ); } sdBase = (SeriesDefinition) axPrimaryBase.getSeriesDefinitions( ) .get( 0 ); // OK TO ASSUME THAT 1 BASE SERIES // DEFINITION EXISTS } else if ( cm instanceof ChartWithoutAxes ) { if ( ( (ChartWithoutAxes) cm ).getSeriesDefinitions( ) .isEmpty( ) ) { return SizeImpl.create( 0, 0 ); } sdBase = (SeriesDefinition) ( (ChartWithoutAxes) cm ).getSeriesDefinitions( ) .get( 0 ); // OK TO ASSUME THAT 1 BASE SERIES // DEFINITION EXISTS } seBase = (Series) sdBase.getRunTimeSeries( ).get( 0 ); // OK TO // ASSUME // THAT 1 // BASE // RUNTIME // SERIES // EXISTS DataSetIterator dsiBase = null; try { dsiBase = new DataSetIterator( seBase.getDataSet( ) ); } catch ( Exception ex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, ex ); } FormatSpecifier fs = null; if ( sdBase != null ) { fs = sdBase.getFormatSpecifier( ); } while ( dsiBase.hasNext( ) ) { // TODO filter the not-used legend. Object obj = dsiBase.next( ); String lgtext = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } la.getCaption( ).setValue( lgtext ); itm.reuse( la, maxWrappingSize ); dDeltaHeight = insCA.getTop( ) + itm.getFullHeight( ) + insCA.getBottom( ); if ( dHeight + dDeltaHeight > dAvailableHeight ) { dExtraWidth += dWidth + insCA.getLeft( ) + insCA.getRight( ) + ( 3 * dItemHeight ) / 2 + dHorizontalSpacing; dWidth = itm.getFullWidth( ); dFullHeight = Math.max( dFullHeight, dHeight ); dHeight = dDeltaHeight; } else { dWidth = Math.max( itm.getFullWidth( ), dWidth ); dHeight += dDeltaHeight; } } // compute the extra MinSlice legend item if applicable. if ( bMinSliceDefined && bMinSliceApplied ) { la.getCaption( ).setValue( sMinSliceLabel ); itm.reuse( la, maxWrappingSize ); dDeltaHeight = insCA.getTop( ) + itm.getFullHeight( ) + insCA.getBottom( ); if ( dHeight + dDeltaHeight > dAvailableHeight ) { dExtraWidth += dWidth + insCA.getLeft( ) + insCA.getRight( ) + ( 3 * dItemHeight ) / 2 + dHorizontalSpacing; dWidth = itm.getFullWidth( ); dFullHeight = Math.max( dFullHeight, dHeight ); dHeight = dDeltaHeight; } else { dWidth = Math.max( itm.getFullWidth( ), dWidth ); dHeight += dDeltaHeight; } } dWidth += insCA.getLeft( ) + ( 3 * dItemHeight ) / 2 + dHorizontalSpacing + insCA.getRight( ) + dExtraWidth; dHeight = Math.max( dFullHeight, dHeight ); } else if ( direction.getValue( ) == Direction.TOP_BOTTOM ) // (VERTICAL // => // TB) { dSeparatorThickness += dVerticalSpacing; for ( int j = 0; j < seda.length; j++ ) { al = seda[j].getRunTimeSeries( ); FormatSpecifier fs = seda[j].getFormatSpecifier( ); for ( int i = 0; i < al.size( ); i++ ) { se = (Series) al.get( i ); Object obj = se.getSeriesIdentifier( ); String lgtext = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } la.getCaption( ).setValue( lgtext ); itm.reuse( la, maxWrappingSize ); dW = itm.getFullWidth( ); dDeltaHeight = insCA.getTop( ) + itm.getFullHeight( ) + insCA.getBottom( ); if ( lg.isShowValue( ) ) { DataSetIterator dsiBase = null; try { dsiBase = new DataSetIterator( se.getDataSet( ) ); } catch ( Exception ex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, ex ); } // Use first value for each series. if ( dsiBase.hasNext( ) ) { obj = dsiBase.next( ); String valueText = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } Label seLabel = (Label) EcoreUtil.copy( se.getLabel( ) ); seLabel.getCaption( ).setValue( valueText ); itm.reuse( seLabel ); dW = Math.max( dW, itm.getFullWidth( ) ); dDeltaHeight += itm.getFullHeight( ) + 2; } } if ( dHeight + dDeltaHeight > dAvailableHeight ) { dExtraWidth += dMaxW + insCA.getLeft( ) + insCA.getRight( ) + ( 3 * dItemHeight ) / 2 + dHorizontalSpacing; dMaxW = dW; dFullHeight = Math.max( dFullHeight, dHeight ); dHeight = dDeltaHeight; } else { dMaxW = Math.max( dW, dMaxW ); dHeight += dDeltaHeight; } } // SETUP HORIZONTAL SEPARATOR SPACING if ( j < seda.length - 1 ) { dHeight += dSeparatorThickness; } } // LEFT INSETS + LEGEND ITEM WIDTH + HORIZONTAL SPACING + MAX // ITEM WIDTH + RIGHT INSETS dWidth = insCA.getLeft( ) + ( 3 * dItemHeight ) / 2 + dHorizontalSpacing + dMaxW + insCA.getRight( ) + dExtraWidth; dHeight = Math.max( dFullHeight, dHeight ); } else if ( direction.getValue( ) == Direction.LEFT_RIGHT ) // (VERTICAL // => // LR) { dSeparatorThickness += dHorizontalSpacing; for ( int j = 0; j < seda.length; j++ ) { al = seda[j].getRunTimeSeries( ); FormatSpecifier fs = seda[j].getFormatSpecifier( ); for ( int i = 0; i < al.size( ); i++ ) { se = (Series) al.get( i ); Object obj = se.getSeriesIdentifier( ); String lgtext = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } la.getCaption( ).setValue( lgtext ); itm.reuse( la, maxWrappingSize ); dW = itm.getFullWidth( ); dDeltaHeight = insCA.getTop( ) + itm.getFullHeight( ) + insCA.getBottom( ); if ( lg.isShowValue( ) ) { DataSetIterator dsiBase = null; try { dsiBase = new DataSetIterator( se.getDataSet( ) ); } catch ( Exception ex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, ex ); } // Use first value for each series. if ( dsiBase.hasNext( ) ) { obj = dsiBase.next( ); String valueText = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } Label seLabel = (Label) EcoreUtil.copy( se.getLabel( ) ); seLabel.getCaption( ).setValue( valueText ); itm.reuse( seLabel ); dW = Math.max( dW, itm.getFullWidth( ) ); dDeltaHeight += itm.getFullHeight( ) + 2; } } if ( dHeight + dDeltaHeight > dAvailableHeight ) { dExtraWidth += dMaxW + insCA.getLeft( ) + insCA.getRight( ) + ( 3 * dItemHeight ) / 2 + dHorizontalSpacing; dMaxW = dW; dFullHeight = Math.max( dFullHeight, dHeight ); dHeight = dDeltaHeight; } else { dMaxW = Math.max( dW, dMaxW ); dHeight += dDeltaHeight; } } dExtraWidth += dMaxW + insCA.getLeft( ) + insCA.getRight( ) + ( 3 * dItemHeight ) / 2 + dHorizontalSpacing; dMaxW = 0; dFullHeight = Math.max( dFullHeight, dHeight ); dHeight = 0; // SETUP VERTICAL SEPARATOR SPACING if ( j < seda.length - 1 ) { dExtraWidth += dSeparatorThickness; } } // LEFT INSETS + LEGEND ITEM WIDTH + HORIZONTAL SPACING + // MAX ITEM WIDTH + RIGHT INSETS dWidth += insCA.getLeft( ) + ( 3 * dItemHeight / 2 ) + dHorizontalSpacing + insCA.getRight( ) + dExtraWidth; dHeight = Math.max( dFullHeight, dHeight ); } else { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, "exception.illegal.rendering.direction", //$NON-NLS-1$ new Object[]{ direction.getName( ) }, ResourceBundle.getBundle( Messages.ENGINE, xs.getLocale( ) ) ); } } else if ( orientation.getValue( ) == Orientation.HORIZONTAL ) { double dH, dMaxH = 0; double dFullWidth = 0, dExtraHeight = 0, dDeltaWidth; if ( bPaletteByCategory ) { SeriesDefinition sdBase = null; if ( cm instanceof ChartWithAxes ) { final Axis axPrimaryBase = ( (ChartWithAxes) cm ).getBaseAxes( )[0]; // ONLY // SUPPORT // 1 // BASE // AXIS // FOR // NOW if ( axPrimaryBase.getSeriesDefinitions( ).isEmpty( ) ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, "exception.base.axis.no.series.definitions", //$NON-NLS-1$ ResourceBundle.getBundle( Messages.ENGINE, xs.getLocale( ) ) ); } sdBase = (SeriesDefinition) axPrimaryBase.getSeriesDefinitions( ) .get( 0 ); // OK TO ASSUME // THAT 1 BASE // SERIES // DEFINITION // EXISTS } else if ( cm instanceof ChartWithoutAxes ) { if ( ( (ChartWithoutAxes) cm ).getSeriesDefinitions( ) .isEmpty( ) ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, "exception.base.axis.no.series.definitions", //$NON-NLS-1$ ResourceBundle.getBundle( Messages.ENGINE, xs.getLocale( ) ) ); } sdBase = (SeriesDefinition) ( (ChartWithoutAxes) cm ).getSeriesDefinitions( ) .get( 0 ); // OK TO ASSUME // THAT 1 BASE // SERIES // DEFINITION // EXISTS } seBase = (Series) sdBase.getRunTimeSeries( ).get( 0 ); // OK TO // ASSUME // THAT 1 // BASE // RUNTIME // SERIES // EXISTS DataSetIterator dsiBase = null; try { dsiBase = new DataSetIterator( seBase.getDataSet( ) ); } catch ( Exception ex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, ex ); } FormatSpecifier fs = null; if ( sdBase != null ) { fs = sdBase.getFormatSpecifier( ); } while ( dsiBase.hasNext( ) ) { // TODO filter the not-used legend. Object obj = dsiBase.next( ); String lgtext = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } la.getCaption( ).setValue( lgtext ); itm.reuse( la, maxWrappingSize ); dDeltaWidth = insCA.getLeft( ) + itm.getFullWidth( ) + ( 3 * dItemHeight ) / 2 + insCA.getRight( ); if ( dWidth + dDeltaWidth > dAvailableWidth ) { dExtraHeight += dHeight + insCA.getTop( ) + insCA.getBottom( ) + dVerticalSpacing; dHeight = itm.getFullHeight( ); dFullWidth = Math.max( dFullWidth, dWidth ); dWidth = dDeltaWidth; } else { dHeight = Math.max( itm.getFullHeight( ), dHeight ); dWidth += dDeltaWidth; } } // compute the extra MinSlice legend item if applicable. if ( bMinSliceDefined && bMinSliceApplied ) { la.getCaption( ).setValue( sMinSliceLabel ); itm.reuse( la, maxWrappingSize ); dDeltaWidth = insCA.getLeft( ) + itm.getFullWidth( ) + ( 3 * dItemHeight ) / 2 + insCA.getRight( ); if ( dWidth + dDeltaWidth > dAvailableWidth ) { dExtraHeight += dHeight + insCA.getTop( ) + insCA.getBottom( ) + dVerticalSpacing; dHeight = itm.getFullHeight( ); dFullWidth = Math.max( dFullWidth, dWidth ); dWidth = dDeltaWidth; } else { dHeight = Math.max( itm.getFullHeight( ), dHeight ); dWidth += dDeltaWidth; } } dHeight += dExtraHeight + insCA.getTop( ) + insCA.getBottom( ) + dVerticalSpacing; dWidth = Math.max( dWidth, dFullWidth ); } else if ( direction.getValue( ) == Direction.TOP_BOTTOM ) // (HORIZONTAL // => // TB) { dSeparatorThickness += dVerticalSpacing; for ( int j = 0; j < seda.length; j++ ) { dWidth = 0; al = seda[j].getRunTimeSeries( ); FormatSpecifier fs = seda[j].getFormatSpecifier( ); for ( int i = 0; i < al.size( ); i++ ) { se = (Series) al.get( i ); Object obj = se.getSeriesIdentifier( ); String lgtext = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } la.getCaption( ).setValue( lgtext ); itm.reuse( la, maxWrappingSize ); dH = itm.getFullHeight( ); dDeltaWidth = insCA.getLeft( ) + ( 3 * dItemHeight ) / 2 + itm.getFullWidth( ) + insCA.getRight( ); if ( lg.isShowValue( ) ) { DataSetIterator dsiBase = null; try { dsiBase = new DataSetIterator( se.getDataSet( ) ); } catch ( Exception ex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, ex ); } // Use first value for each series. if ( dsiBase.hasNext( ) ) { obj = dsiBase.next( ); String valueText = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } Label seLabel = (Label) EcoreUtil.copy( se.getLabel( ) ); seLabel.getCaption( ).setValue( valueText ); itm.reuse( seLabel ); dH += itm.getFullHeight( ) + 2; dDeltaWidth = Math.max( dDeltaWidth, itm.getFullWidth( ) ); } } if ( dWidth + dDeltaWidth > dAvailableWidth ) { dExtraHeight += dMaxH + insCA.getTop( ) + insCA.getBottom( ) + dVerticalSpacing; dMaxH = dH; dFullWidth = Math.max( dFullWidth, dWidth ); dWidth = dDeltaWidth; } else { dMaxH = Math.max( dH, dMaxH ); dWidth += dDeltaWidth; } } dExtraHeight += dMaxH + insCA.getTop( ) + insCA.getBottom( ) + dVerticalSpacing; dMaxH = 0; dFullWidth = Math.max( dFullWidth, dWidth ); dWidth = 0; // SETUP HORIZONTAL SEPARATOR SPACING if ( j < seda.length - 1 ) { dHeight += dSeparatorThickness; } } dHeight += insCA.getTop( ) + dVerticalSpacing + insCA.getBottom( ) + dExtraHeight; dWidth = Math.max( dFullWidth, dWidth ); } else if ( direction.getValue( ) == Direction.LEFT_RIGHT ) // (HORIZONTAL // => // LR) { dSeparatorThickness += dHorizontalSpacing; for ( int j = 0; j < seda.length; j++ ) { al = seda[j].getRunTimeSeries( ); FormatSpecifier fs = seda[j].getFormatSpecifier( ); for ( int i = 0; i < al.size( ); i++ ) { se = (Series) al.get( i ); Object obj = se.getSeriesIdentifier( ); String lgtext = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } la.getCaption( ).setValue( lgtext ); itm.reuse( la, maxWrappingSize ); dH = itm.getFullHeight( ); dDeltaWidth = insCA.getLeft( ) + ( 3 * dItemHeight ) / 2 + itm.getFullWidth( ) + insCA.getRight( ); if ( lg.isShowValue( ) ) { DataSetIterator dsiBase = null; try { dsiBase = new DataSetIterator( se.getDataSet( ) ); } catch ( Exception ex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, ex ); } // Use first value for each series. if ( dsiBase.hasNext( ) ) { obj = dsiBase.next( ); String valueText = String.valueOf( obj ); if ( fs != null ) { try { lgtext = ValueFormatter.format( obj, fs, Locale.getDefault( ), null ); } catch ( ChartException e ) { // ignore, use original text. } } Label seLabel = (Label) EcoreUtil.copy( se.getLabel( ) ); seLabel.getCaption( ).setValue( valueText ); itm.reuse( seLabel ); dH += itm.getFullHeight( ) + 2; dDeltaWidth = Math.max( dDeltaWidth, itm.getFullWidth( ) ); } } if ( dWidth + dDeltaWidth > dAvailableWidth ) { dExtraHeight += dMaxH + insCA.getTop( ) + insCA.getBottom( ) + dVerticalSpacing; dMaxH = dH; dFullWidth = Math.max( dFullWidth, dWidth ); dWidth = dDeltaWidth; } else { dMaxH = Math.max( dH, dMaxH ); dWidth += dDeltaWidth; } } // SETUP VERTICAL SEPARATOR SPACING if ( j < seda.length - 1 ) { dWidth += dSeparatorThickness; } } dHeight += insCA.getTop( ) + dVerticalSpacing + insCA.getBottom( ) + dMaxH + dExtraHeight; dWidth = Math.max( dFullWidth, dWidth ); } else { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, "exception.illegal.rendering.direction", //$NON-NLS-1$ new Object[]{ direction }, ResourceBundle.getBundle( Messages.ENGINE, xs.getLocale( ) ) ); } } else { throw new ChartException( ChartEnginePlugin.ID, ChartException.GENERATION, "exception.illegal.rendering.orientation", //$NON-NLS-1$ new Object[]{ orientation }, ResourceBundle.getBundle( Messages.ENGINE, xs.getLocale( ) ) ); } // consider legend title size. Label lgTitle = lg.getTitle( ); if ( lgTitle != null && lgTitle.isSetVisible( ) && lgTitle.isVisible( ) ) { BoundingBox bb = null; try { bb = Methods.computeBox( xs, IConstants.ABOVE, lgTitle, 0, 0 ); } catch ( IllegalArgumentException uiex ) { throw new ChartException( ChartEnginePlugin.ID, ChartException.RENDERING, uiex ); } switch ( lg.getTitlePosition( ).getValue( ) ) { case Position.ABOVE : case Position.BELOW : dHeight += bb.getHeight( ); dWidth = Math.max( dWidth, bb.getWidth( ) ); break; case Position.LEFT : case Position.RIGHT : dWidth += bb.getWidth( ); dHeight = Math.max( dHeight, bb.getHeight( ) ); break; } } itm.dispose( ); // DISPOSE RESOURCE AFTER USE if ( rtc != null ) { LegendItemLayoutHints lilh = new LegendItemLayoutHints( ); lilh.set( SizeImpl.create( dWidth, dHeight ) ); rtc.setLegendItemLayoutHints( lilh ); } sz = SizeImpl.create( dWidth, dHeight ); return sz; }
46013 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/46013/ad38cf76f1d641ada210d2a5b0551677d4e55a71/LegendBuilder.java/buggy/chart/org.eclipse.birt.chart.engine/src/org/eclipse/birt/chart/computation/LegendBuilder.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 727, 6321, 3671, 12, 1599, 291, 1601, 2081, 9280, 16, 14804, 5003, 16, 1082, 202, 6485, 1852, 8526, 24336, 69, 16, 1939, 950, 1042, 436, 5111, 262, 1216, 14804, 503, 202, 95, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 727, 6321, 3671, 12, 1599, 291, 1601, 2081, 9280, 16, 14804, 5003, 16, 1082, 202, 6485, 1852, 8526, 24336, 69, 16, 1939, 950, 1042, 436, 5111, 262, 1216, 14804, 503, 202, 95, ...
if (result != null) { if (result instanceof Element || result instanceof Document) { Node node = (Node) result; DOMGenerator domGenerator = new DOMGenerator(node); ProcessorOutput domOutput = domGenerator.createOutput(OUTPUT_DATA); domOutput.read(context, new ForwardingContentHandler(contentHandler) { public void startDocument() { }
if ( result == null ) continue; final String strVal; if ( result instanceof org.dom4j.Element || result instanceof org.dom4j.Document ) { final org.dom4j.Element elt = result instanceof org.dom4j.Element ? ( org.dom4j.Element )result : ( ( org.dom4j.Document )result ).getRootElement(); final String sid = Dom4jUtils.makeSystemId( elt ); final DOMGenerator domGenerator = new DOMGenerator ( elt, "xpath result doc", DOMGenerator.ZeroValidity, sid ); final ProcessorOutput domOutput = domGenerator.createOutput( OUTPUT_DATA ); domOutput.read(context, new ForwardingContentHandler(contentHandler) { public void startDocument() { }
public void readImpl(org.orbeon.oxf.pipeline.api.PipelineContext context, ContentHandler contentHandler) { Config config = (Config) readCacheInputAsObject(context, getInputByName(INPUT_CONFIG), new CacheableInputReader() { public Object read(final org.orbeon.oxf.pipeline.api.PipelineContext context, final ProcessorInput input) { Document config = readInputAsDOM4J(context, INPUT_CONFIG); // Get declared namespaces Map namespaces = new HashMap(); for (Iterator i = config.getRootElement().selectNodes("/config/namespace").iterator(); i.hasNext();) { Element namespaceElement = (Element) i.next(); namespaces.put(namespaceElement.attributeValue("prefix"), namespaceElement.attributeValue("uri")); } // Create xpath object (Jaxen)// XPath xpath = XPathCache.createCacheXPath(context, (String) config.selectObject("string(/config/xpath)"));// xpath.setNamespaceContext(new SimpleNamespaceContext(namespaces));// xpath.setFunctionContext(new OXFFunctionContext());// return xpath; return new Config(namespaces, (String) config.selectObject("string(/config/xpath)")); } });// List results = xpath.selectNodes(readCacheInputAsDOM4J(context, INPUT_DATA)); DocumentWrapper wrapper = new DocumentWrapper(readCacheInputAsDOM4J(context, INPUT_DATA), null); PooledXPathExpression xpath = null; try { xpath = XPathCache.getXPathExpression(context, wrapper, config.getExpression(), config.getNamespaces()); List results = xpath.evaluate(); contentHandler.startDocument(); // WARNING: Here we break the rule that processors must output valid XML documents, because // we potentially output several root nodes. This works because the XPathProcessor is always // connected to an aggregator, which adds a new root node. for (Iterator i = results.iterator(); i.hasNext();) { Object result = i.next(); if (result != null) { if (result instanceof Element || result instanceof Document) { Node node = (Node) result; DOMGenerator domGenerator = new DOMGenerator(node); ProcessorOutput domOutput = domGenerator.createOutput(OUTPUT_DATA); domOutput.read(context, new ForwardingContentHandler(contentHandler) { public void startDocument() { } public void endDocument() { } }); } else if (result instanceof String) { String stringValue = (String) result; contentHandler.characters(stringValue.toCharArray(), 0, stringValue.length()); } else if (result instanceof Double) { String stringValue = XMLUtils.removeScientificNotation(((Double) result).doubleValue()); contentHandler.characters(stringValue.toCharArray(), 0, stringValue.length()); } else { String message = "Unsupported type returned by XPath expression: " + (result == null ? "null" : result.getClass().getName()); throw new ValidationException(message, locationData); } } } contentHandler.endDocument(); }catch (XPathException xpe) { throw new OXFException(xpe); } catch (SAXException e) { throw new ValidationException(e, locationData); }finally{ if(xpath != null) xpath.returnToPool(); } }
57229 /local/tlutelli/issta_data/temp/all_java5context/java/2006_temp/2006/57229/558be30a09b76fdcd48f89d08b1308f894e34fcb/XPathProcessor.java/clean/src/java/org/orbeon/oxf/processor/transformer/XPathProcessor.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 918, 855, 2828, 12, 3341, 18, 280, 2196, 265, 18, 2409, 74, 18, 14511, 18, 2425, 18, 8798, 1042, 819, 16, 3697, 1503, 913, 1503, 13, 288, 9079, 1903, 642, 273, 261, 809, 13, 85...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 2398, 1071, 918, 855, 2828, 12, 3341, 18, 280, 2196, 265, 18, 2409, 74, 18, 14511, 18, 2425, 18, 8798, 1042, 819, 16, 3697, 1503, 913, 1503, 13, 288, 9079, 1903, 642, 273, 261, 809, 13, 85...
public void startDocument() {
public void startDocument() throws SAXException {
public void startDocument() { mDocument = new Document(); }
1514 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/1514/7d7e290d340adbb36187056fb2a2c3cd7bbcaa77/XMLDocumentHandlerSAX.java/buggy/sandbox/contributions/XML-Indexing-Demo/src/java/org/apache/lucenesandbox/xmlindexingdemo/XMLDocumentHandlerSAX.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 787, 2519, 1435, 1216, 14366, 288, 565, 312, 2519, 273, 394, 4319, 5621, 225, 289, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 787, 2519, 1435, 1216, 14366, 288, 565, 312, 2519, 273, 394, 4319, 5621, 225, 289, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, ...
FieldTable result = new FieldTable();
FieldTable result = FieldTableFactory.newFieldTable();
public void testKeyEnumeration() { FieldTable result = new FieldTable(); result.put("one", 1L); result.put("two", 2L); result.put("three", 3L); result.put("four", 4L); result.put("five", 5L); Iterator iterator = result.keySet().iterator(); try { assertTrue("one".equals(iterator.next())); assertTrue("two".equals(iterator.next())); assertTrue("three".equals(iterator.next())); assertTrue("four".equals(iterator.next())); assertTrue("five".equals(iterator.next())); } catch (NoSuchElementException e) { fail("All elements should be found."); } }
45585 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/45585/2e4d9c40a39cb0a89cfaae57a3aaca97ce133fbc/FieldTableKeyEnumeratorTest.java/buggy/qpid/java/client/src/test/java/org/apache/qpid/test/unit/basic/FieldTableKeyEnumeratorTest.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1842, 653, 21847, 1435, 565, 288, 3639, 2286, 1388, 563, 273, 2286, 1388, 1733, 18, 2704, 974, 1388, 5621, 3639, 563, 18, 458, 2932, 476, 3113, 404, 48, 1769, 3639, 563, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1842, 653, 21847, 1435, 565, 288, 3639, 2286, 1388, 563, 273, 2286, 1388, 1733, 18, 2704, 974, 1388, 5621, 3639, 563, 18, 458, 2932, 476, 3113, 404, 48, 1769, 3639, 563, 18, ...
Map<Object, Object> m = getMap();
Map<AnalysisLocal<T>, T> m = getMap();
public void remove() { Map<Object, Object> m = getMap(); m.remove(this); }
10715 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/10715/d3d8e80793491a30b8151a4f7df75f6bb82a3f59/AnalysisLocal.java/buggy/findbugs/src/java/edu/umd/cs/findbugs/AnalysisLocal.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 225, 918, 225, 1206, 1435, 288, 202, 202, 863, 32, 921, 16, 1033, 34, 312, 273, 15489, 5621, 202, 202, 81, 18, 4479, 12, 2211, 1769, 202, 97, 2, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 225, 918, 225, 1206, 1435, 288, 202, 202, 863, 32, 921, 16, 1033, 34, 312, 273, 15489, 5621, 202, 202, 81, 18, 4479, 12, 2211, 1769, 202, 97, 2, -100, -100, -100, -100, -100...
encryptedHeader = mps.protectHeader(rawData, source, destination);
try { encryptedHeader = mps.protectHeader(rawData, source, destination); } catch (Exception e) { e.printStackTrace(); Assert.assertTrue("Exception while trying to encrypt header", false); }
public void testHeaderEncryption() { // Create a test header String header = "Source:foo - Target:bar"; byte[] rawData = header.getBytes(); MessageAddress source = new MessageAddress("foo"); MessageAddress destination = new MessageAddress("bar"); byte[] encryptedHeader = null; byte[] decryptedHeader = null; // Encrypt header encryptedHeader = mps.protectHeader(rawData, source, destination); Assert.assertNotNull("Encrypted Header is null", encryptedHeader); // Decrypt header decryptedHeader = mps.unprotectHeader(encryptedHeader, source, destination); String newHeader = new String (decryptedHeader); Assert.assertNotNull("Deccrypted Header is null", decryptedHeader); // Original header and (encrypted then decrypted) header should be equal. Assert.assertEquals(header, newHeader); // Original header and encrypted header should be different // (but of course that does not guarantee that encryption is done properly) boolean isDifferent = !header.equals(new String(encryptedHeader)); Assert.assertTrue(isDifferent); System.out.println("Header before encryption: " + header); //System.out.println("Header after encryption: " + new String(encryptedHeader)); System.out.println("Header after encryption/decryption: " + newHeader); }
12869 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/12869/d293fe3e5ebdb257a29487cc4600f66f408b45f5/MessageProtectionServiceTest.java/clean/securityservices/regress/test/org/cougaar/core/security/crypto/MessageProtectionServiceTest.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 1842, 1864, 7894, 1435, 288, 565, 368, 1788, 279, 1842, 1446, 565, 514, 1446, 273, 315, 1830, 30, 11351, 300, 5916, 30, 3215, 14432, 565, 1160, 8526, 16503, 273, 1446, 18, 588,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 918, 1842, 1864, 7894, 1435, 288, 565, 368, 1788, 279, 1842, 1446, 565, 514, 1446, 273, 315, 1830, 30, 11351, 300, 5916, 30, 3215, 14432, 565, 1160, 8526, 16503, 273, 1446, 18, 588,...
else { moduleHandle.includeLibrary( DEUtil.getRelativedPath( moduleHandle.getFileName( ), libraryHandle.getFileName( ) ), defaultName ); ExceptionHandler.openMessageBox( MSG_DIALOG_TITLE, MessageFormat.format( MSG_DIALOG_MSG, new String[]{ libraryHandle.getFileName( ) } ), SWT.ICON_INFORMATION ); return true; }
moduleHandle.includeLibrary( DEUtil.getRelativedPath( moduleHandle.getFileName( ), libraryHandle.getFileName( ) ), defaultName ); ExceptionHandler.openMessageBox( MSG_DIALOG_TITLE, MessageFormat.format( MSG_DIALOG_MSG, new String[]{ libraryHandle.getFileName( ) } ), SWT.ICON_INFORMATION ); return true;
public static boolean includeLibrary( ModuleHandle moduleHandle, LibraryHandle libraryHandle ) throws DesignFileException, SemanticException { if ( moduleHandle!=libraryHandle && !moduleHandle.isInclude( libraryHandle ) ) { String defaultName = new File( libraryHandle.getFileName( ) ).getName( ) .split( File.separator + "." )[0]; if ( SessionHandleAdapter.getInstance( ) .getReportDesignHandle( ) .getLibrary( defaultName ) != null ) { ImportLibraryDialog dialog = new ImportLibraryDialog( defaultName ); if ( dialog.open( ) == Dialog.OK ) { moduleHandle.includeLibrary( DEUtil.getRelativedPath( moduleHandle.getFileName( ), libraryHandle.getFileName( ) ), (String) dialog.getResult( ) ); ExceptionHandler.openMessageBox( MSG_DIALOG_TITLE, MessageFormat.format( MSG_DIALOG_MSG, new String[]{ libraryHandle.getFileName( ) } ), SWT.ICON_INFORMATION ); return true; } return false; } else { moduleHandle.includeLibrary( DEUtil.getRelativedPath( moduleHandle.getFileName( ), libraryHandle.getFileName( ) ), defaultName ); ExceptionHandler.openMessageBox( MSG_DIALOG_TITLE, MessageFormat.format( MSG_DIALOG_MSG, new String[]{ libraryHandle.getFileName( ) } ), SWT.ICON_INFORMATION ); return true; } } return true; }
12803 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/12803/a11c61344fea2c7dd935e6c4bd0e49a1b90c426e/UIUtil.java/buggy/UI/org.eclipse.birt.report.designer.ui/src/org/eclipse/birt/report/designer/internal/ui/util/UIUtil.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 1250, 2341, 9313, 12, 5924, 3259, 1605, 3259, 16, 1082, 202, 9313, 3259, 5313, 3259, 262, 1216, 29703, 812, 503, 16, 1082, 202, 13185, 9941, 503, 202, 95, 202, 202, 430, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 760, 1250, 2341, 9313, 12, 5924, 3259, 1605, 3259, 16, 1082, 202, 9313, 3259, 5313, 3259, 262, 1216, 29703, 812, 503, 16, 1082, 202, 13185, 9941, 503, 202, 95, 202, 202, 430, ...
boolean isDefaultPageEncoding) throws JasperException {
boolean isDefaultPageEncoding, boolean isBomPresent) throws JasperException {
public static Node.Nodes parse(ParserController pc, JspReader reader, Node parent, boolean isTagFile, boolean directivesOnly, URL jarFileUrl, String pageEnc, String jspConfigPageEnc, boolean isDefaultPageEncoding) throws JasperException { Parser parser = new Parser(pc, reader, isTagFile, directivesOnly, jarFileUrl); Node.Root root = new Node.Root(reader.mark(), parent, false); root.setPageEncoding(pageEnc); root.setJspConfigPageEncoding(jspConfigPageEnc); root.setIsDefaultPageEncoding(isDefaultPageEncoding); if (directivesOnly) { parser.parseTagFileDirectives(root); return new Node.Nodes(root); } // For the Top level page, add inlcude-prelude and include-coda PageInfo pageInfo = pc.getCompiler().getPageInfo(); if (parent == null) { parser.addInclude(root, pageInfo.getIncludePrelude()); } while (reader.hasMoreInput()) { parser.parseElements(root); } if (parent == null) { parser.addInclude(root, pageInfo.getIncludeCoda()); } Node.Nodes page = new Node.Nodes(root); return page; }
15905 /local/tlutelli/issta_data/temp/all_java1context/java/2006_temp/2006/15905/7e55d59e7a32637ca63b2cec65835a56dd760a98/Parser.java/clean/java/org/apache/jasper/compiler/Parser.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 2029, 18, 3205, 1109, 12, 2678, 2933, 6125, 16, 19300, 2514, 2949, 16, 5411, 2029, 982, 16, 1250, 353, 1805, 812, 16, 1250, 13877, 3386, 16, 5411, 1976, 22588, 1489, 16, 514, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 760, 2029, 18, 3205, 1109, 12, 2678, 2933, 6125, 16, 19300, 2514, 2949, 16, 5411, 2029, 982, 16, 1250, 353, 1805, 812, 16, 1250, 13877, 3386, 16, 5411, 1976, 22588, 1489, 16, 514, ...
public boolean isOperationVisible() { return _operVec.isDisplayed(); }
public boolean isOperationVisible() { return _operVec.isDisplayed(); }
public boolean isOperationVisible() { return _operVec.isDisplayed(); }
7166 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/7166/81987ae96ab1399b8d43a27c69be7d7a4c0b7b89/FigClass.java/clean/src_new/org/argouml/uml/diagram/static_structure/ui/FigClass.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 1250, 353, 2988, 6207, 1435, 288, 327, 389, 4063, 12991, 18, 291, 4236, 329, 5621, 289, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 1250, 353, 2988, 6207, 1435, 288, 327, 389, 4063, 12991, 18, 291, 4236, 329, 5621, 289, 2, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, -100, ...
locatorImpl.setSystemId(e.getSystemId());
locatorImpl.setSystemId(e.getExpandedSystemId());
public void parse(String systemId) throws SAXException, IOException { // parse document XMLInputSource source = new XMLInputSource(null, systemId, null); try { parse(source); } // wrap XNI exceptions as SAX exceptions catch (XMLParseException e) { Exception ex = e.getException(); if (ex == null) { // must be a parser exception; mine it for locator info and throw // a SAXParseException LocatorImpl locatorImpl = new LocatorImpl(); locatorImpl.setPublicId(e.getPublicId()); locatorImpl.setSystemId(e.getSystemId()); locatorImpl.setLineNumber(e.getLineNumber()); locatorImpl.setColumnNumber(e.getColumnNumber()); throw new SAXParseException(e.getMessage(), locatorImpl); } if (ex instanceof SAXException) { // why did we create an XMLParseException? throw (SAXException)ex; } if (ex instanceof IOException) { throw (IOException)ex; } throw new SAXException(ex); } catch (XNIException e) { Exception ex = e.getException(); if (ex == null) { throw new SAXException(e.getMessage()); } if (ex instanceof SAXException) { throw (SAXException)ex; } if (ex instanceof IOException) { throw (IOException)ex; } throw new SAXException(ex); } // close stream opened by the parser finally { try { Reader reader = source.getCharacterStream(); if (reader != null) { reader.close(); } else { InputStream is = source.getByteStream(); if (is != null) { is.close(); } } } catch (IOException e) { // ignore } } } // parse(String)
1831 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/1831/bda39ebfdde5204af457e868d6a2908461900e9f/AbstractSAXParser.java/buggy/src/org/apache/xerces/parsers/AbstractSAXParser.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1109, 12, 780, 30083, 13, 1216, 14366, 16, 1860, 288, 3639, 368, 1109, 1668, 3639, 3167, 1210, 1830, 1084, 273, 394, 3167, 1210, 1830, 12, 2011, 16, 30083, 16, 446, 1769, 3639,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 1071, 918, 1109, 12, 780, 30083, 13, 1216, 14366, 16, 1860, 288, 3639, 368, 1109, 1668, 3639, 3167, 1210, 1830, 1084, 273, 394, 3167, 1210, 1830, 12, 2011, 16, 30083, 16, 446, 1769, 3639,...
allocate(nrargs);
nrargs = 0;
public void setDefault() { int i; int nrargs; database = null; nrargs = 0; allocate(nrargs); for (i=0;i<nrargs;i++) { argument [i]="arg"+i; //$NON-NLS-1$ argumentDirection [i]="IN"; //$NON-NLS-1$ argumentType[i]=Value.VALUE_TYPE_NUMBER; } resultName = "result"; //$NON-NLS-1$ resultType = Value.VALUE_TYPE_NUMBER; }
9547 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/9547/3813bb349b7f599dec545d693a38e0bf9749c3c1/DBProcMeta.java/clean/src/be/ibridge/kettle/trans/step/dbproc/DBProcMeta.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 9277, 1435, 202, 95, 202, 202, 474, 277, 31, 202, 202, 474, 9884, 1968, 31, 9506, 202, 6231, 273, 446, 31, 202, 202, 11611, 1968, 565, 273, 374, 31, 202, 202, 16247, 12...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 225, 202, 482, 918, 9277, 1435, 202, 95, 202, 202, 474, 277, 31, 202, 202, 474, 9884, 1968, 31, 9506, 202, 6231, 273, 446, 31, 202, 202, 11611, 1968, 565, 273, 374, 31, 202, 202, 16247, 12...
protected void assertContains(int expected, int[] array) {
protected void assertContains(char expected, char[] array) {
protected void assertContains(int expected, int[] array) { for (int i = 0; i < array.length; ++i) { if (array[i] == expected) { return; } } StringBuffer message = new StringBuffer(); message.append(expected + " not in {"); for (int i = 0; i < array.length; ++i) { message.append("'" + array[i] + "'"); if (i < (array.length - 1)) { message.append(", "); } } message.append(" }"); fail(message.toString()); }
6462 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/6462/1fc892515bece739b5ec210547694b980de442cf/GroovyTestCase.java/buggy/src/main/groovy/util/GroovyTestCase.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 918, 1815, 10846, 12, 3001, 2665, 16, 1149, 8526, 526, 13, 288, 3639, 364, 261, 474, 277, 273, 374, 31, 277, 411, 526, 18, 2469, 31, 965, 77, 13, 288, 5411, 309, 261, 1126, 63, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 4750, 918, 1815, 10846, 12, 3001, 2665, 16, 1149, 8526, 526, 13, 288, 3639, 364, 261, 474, 277, 273, 374, 31, 277, 411, 526, 18, 2469, 31, 965, 77, 13, 288, 5411, 309, 261, 1126, 63, ...
int maxWidth = doubleBufferMaximumSize.width; int maxHeight = doubleBufferMaximumSize.height; return comp.createVolatileImage(Math.min(maxWidth, proposedWidth), Math.min(maxHeight, proposedHeight));
Component root = getRoot(comp); Image buffer = (Image) offscreenBuffers.get(root); if (buffer == null || buffer.getWidth(null) < proposedWidth || buffer.getHeight(null) < proposedHeight || !(buffer instanceof VolatileImage)) { int width = Math.max(proposedWidth, root.getWidth()); width = Math.min(doubleBufferMaximumSize.width, width); int height = Math.max(proposedHeight, root.getHeight()); height = Math.min(doubleBufferMaximumSize.height, height); buffer = root.createVolatileImage(width, height); if (buffer != null) offscreenBuffers.put(root, buffer); } return buffer;
public Image getVolatileOffscreenBuffer(Component comp, int proposedWidth, int proposedHeight) { int maxWidth = doubleBufferMaximumSize.width; int maxHeight = doubleBufferMaximumSize.height; return comp.createVolatileImage(Math.min(maxWidth, proposedWidth), Math.min(maxHeight, proposedHeight)); }
1056 /local/tlutelli/issta_data/temp/all_java0context/java/2006_temp/2006/1056/53983e95556bf4b775130b06570aa2ea08d85628/RepaintManager.java/buggy/core/src/classpath/javax/javax/swing/RepaintManager.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 3421, 11031, 355, 20295, 7210, 9252, 1892, 12, 1841, 1161, 16, 509, 20084, 2384, 16, 4766, 1850, 509, 20084, 2686, 13, 225, 288, 565, 509, 17681, 273, 1645, 1892, 13528, 1225, 18, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 282, 1071, 3421, 11031, 355, 20295, 7210, 9252, 1892, 12, 1841, 1161, 16, 509, 20084, 2384, 16, 4766, 1850, 509, 20084, 2686, 13, 225, 288, 565, 509, 17681, 273, 1645, 1892, 13528, 1225, 18, 2...
if (hb.isProcessed() || !hb.getMustUnderstand()) {
if (headerBlock.isProcessed() || !headerBlock.getMustUnderstand()) {
private void checkMustUnderstand(MessageContext msgContext) throws AxisFault { if (!msgContext.isHeaderPresent()) { return; } SOAPEnvelope se = msgContext.getEnvelope(); if (se.getHeader() == null) { return; } Iterator hbs = se.getHeader().examineAllHeaderBlocks(); while (hbs.hasNext()) { SOAPHeaderBlock hb = (SOAPHeaderBlock) hbs.next(); // if this header block has been processed or mustUnderstand isn't // turned on then its cool if (hb.isProcessed() || !hb.getMustUnderstand()) { continue; } // if this header block is not targetted to me then its not my // problem. Currently this code only supports the "next" role; we // need to fix this to allow the engine/service to be in one or more // additional roles and then to check that any headers targetted for // that role too have been dealt with. String role = hb.getRole(); String prefix = se.getNamespace().getPrefix(); if (!msgContext.isSOAP11()) { // if must understand and soap 1.2 the Role should be NEXT , if it is null we considerr // it to be NEXT if (prefix == null || "".equals(prefix)) { prefix = SOAPConstants.SOAPFAULT_NAMESPACE_PREFIX; } if (role != null) { if (!SOAP12Constants.SOAP_ROLE_NEXT.equals(role)) { throw new AxisFault(Messages.getMessage( "mustunderstandfaild", prefix, SOAP12Constants.FAULT_CODE_MUST_UNDERSTAND)); } } else { throw new AxisFault(Messages.getMessage( "mustunderstandfaild", prefix, SOAP12Constants.FAULT_CODE_MUST_UNDERSTAND)); } } else { // if must understand and soap 1.1 the actor should be NEXT , if it is null we considerr // it to be NEXT if ((role != null) && !SOAP11Constants.SOAP_ACTOR_NEXT.equals(role)) { throw new AxisFault(Messages.getMessage( "mustunderstandfaild", prefix, SOAP12Constants.FAULT_CODE_MUST_UNDERSTAND)); } } } }
49300 /local/tlutelli/issta_data/temp/all_java4context/java/2006_temp/2006/49300/66aeed666bb41a48d1fabc0c431ffb9a522c191b/AxisEngine.java/clean/modules/core/src/org/apache/axis2/engine/AxisEngine.java
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 866, 10136, 14655, 10145, 12, 1079, 1042, 1234, 1042, 13, 1216, 15509, 7083, 288, 3639, 309, 16051, 3576, 1042, 18, 291, 1864, 6351, 10756, 288, 5411, 327, 31, 3639, 289, 3639, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
[ 1, 8585, 326, 22398, 316, 326, 981, 30, 377, 3238, 918, 866, 10136, 14655, 10145, 12, 1079, 1042, 1234, 1042, 13, 1216, 15509, 7083, 288, 3639, 309, 16051, 3576, 1042, 18, 291, 1864, 6351, 10756, 288, 5411, 327, 31, 3639, 289, 3639, ...