text stringlengths 226 34.5k |
|---|
Why isn't my webapp2 import / Google App Engine "Hello, World" working?
Question: While I'm able to get my "Hello, World" program running on Google App Engine
(GAE), it only works when I create a version that doesn't rely on the webapp2
import. Why isn't the import working? What I need to do to fix it?
Version of hell... |
python count number of ones in a binary image
Question: What is the python module to count number of ones in a binary image ?
to rephrase,
I have a matrix that has only ones and zeros, it's of numpy array type and I
want to know how many ones are there.
Answer: You can simply use `sum`:
>>> import nu... |
Quit function in python program
Question: I have a program that runs in Python, without the console present (which is to
say, I've compiled it using py2exe). I want people to be able to quit from the
main menu, or by a particular key-press in-game (say, Shift+Q). I'm running
it, for now, in Windows, though I am working... |
Django - consecutive dumpdata calls fail, even though work correctly when run separately
Question: I've run into an issue trying to set up automatic backups on my site. The
problem boils down to the following.
I open the Python shell and I call the dumpdata command twice. It **works**
for the first time and it returns... |
basic multiprocessing with python
Question: I have found information on multiprocessing and multithreading in python but I
don't understand the basic concepts and all the examples that I found are more
difficult than what I'm trying to do.
I have X independent programs that I need to run. I want to launch the first Y
... |
java.io.FileNotFoundException: C:\Program Files\Apache Software Foundation\Tomcat 7.0\logs\localhost_access_log.2012-07-12.txt (Access is denied)
Question: I'm trying to test my servlet by running it on Tomcat. However, I get the
above error (sometimes this error occurs, but earlier the servlet was running
fine). A few... |
Python Multithreading missing data
Question: useI am working on a python script to check if the url is working. The script
will write the url and response code to a log file. To speed up the check, I
am using threading and queue.
The script works well if the number of url's to check is small but when
increasing the nu... |
Python client won't reconnect to server
Question: I'm sorry for my English, but I've some problems with my software and I need
some help. But first of all, some code!
Client side:
if connessione.connect(host, port) == True:
connect = True
print 'connection granted'
else:
conn... |
itertools functions not showing up in pydev quick fix
Question: Using python 2.7.2 and pydev 2.5.0 and I can't seem to get eclipse to ever
suggest any functions from itertools as suggestion.
For example quick fixing the given the following: chain([1, 2, 3], [4, 5, 6])
Only gives logilab.common.compat as an option for... |
DrawingPanel.py Drawing a rubik's cube
Question: using python i'd like to draw a rubik's cube based on this picture
<http://vixra.files.wordpress.com/2010/0> ... s-cube.jpg
this is my current code <http://pastebin.com/MfF07ze4>
but i'd like the code to have at least 5 for loops and 5 functions that will
aid in the cr... |
Billing aliens via POS printer and image print
Question: I am trying to create a prototype to print bitmap data for a text file to my
LAN enabled epson pos printer TM-T88V.
While I have no problems to send text and text formatting instructions, I dont
understand, what I have to do, to make my printer print the data of... |
How to run an xpath over html page in python?
Question: I think using lxml library in python can help, but not able to find out how to
do this??
Answer: A simple starting point...
import lxml.html
page = lxml.html.parse('http://www.google.com').getroot()
print page.xpath('//a/@href')
|
Why can urlopen download a Google search page but not a Google Scholar search page?
Question: I'm using **Python 3.2.3's** `urllib.request` module to download Google search
results, but I'm getting an odd error in that `urlopen` works with links to
Google search results, but not Google Scholar. In this example, I'm sea... |
python example for reading multiple protobuf messages from a stream
Question: I'm working with data from spinn3r, which consists of multiple different
protobuf messages serialized into a byte stream:
<http://code.google.com/p/spinn3r-client/wiki/Protostream>
"A protostream is a stream of protocol buffer messages, enc... |
Transform filter function to Python code
Question: I'm trying to understand how to transform a filter, in this case a
Notch(stopband) filter, to Python but I don't know how.
x(n)=-2*x(n)/(-0.9*x(n) -0.9*x(n-1))
Can anyone help me please?
Thanks in advance.
Answer: If you're using numpy arrays, t... |
How should I get Open Graph JSON object to pass in facepy class
Question: I am trying to configure Open Graph in my app such that, when ever a person
click a "link" in it, the app should "post" it on his feeds/ timeline/
activity. (_`I created open graph actions for these features and successfully
added meta tags in th... |
error when importing ijson module python
Question: I need to parse some large (2 Gb+) files into python. I have tried it with the
json module but I get a memory error as its methods all load the files at
once. I then moved on into installing ijson which suposedly implements a
iterator-based way of parsing the file. How... |
Why is the unittest's assert methods slower than raw assertion?
Question: unittest comes with many assert methods. I did a timeit test on using built-in
Python `assert` and comparison operator vs built-in simple unittest assertion.
#!/usr/bin/python
import timeit
s = """\
import unittest... |
Import Local module over global python
Question: I have a 2 python files. One is trying to import the second. My problem is
that the second is named math.py. I can not rename it. When I attempt to call
a function that is located inside math.py, I can not because I end up with the
global math module. How would I import ... |
No autoincrement for Integer Primary key in sqlite3
Question: In the sqlite3 [faq](http://www.sqlite.org/faq.html#q1), it is mentioned that
an integer primary key being fed a null value would autoincrement. But this is
not happening for me.
to replicate, a table in sqlite3, `CREATE TABLE dummy( serial_num INTEGER
PRIM... |
How do I check lists of numeric data for a certain number using an "if" statement in Python?
Question: Currently, I am attempting to retrieve numeric data from different CSV files.
I then place that data in lists in Python. However, I'm struggling to get
Python to determine if there is a value in each separate list of ... |
Python repeating CSV file
Question: I'm attempting to load numerical data from CSV files in order to loop through
the calculated data of each stock(file) separately and determine if the
calculated value is greater than a specific number (731 in this case).
However, the method I am using seems to make Python repeat the ... |
Importing from sub-folder hierarchy in python
Question: i am trying to import specified modules from test_file hierarchy
something like :
test_case1.py
test_subsuite_2
test_sub_2.1.1.py
test_suite2
is it possible to do a run import on this hierarchy
/project/main.py
... |
Python: Put values of variables into a new dictionary
Question: I am looking for a solution to put the content of 2 variables into a
dictionary. One variable should serve as the key, the other as the value.
Here's my code:
dom = parseString(data)
macro=dom.getElementsByTagName('macro')
for node ... |
django.core.exceptions.ImproperlyConfigured: App with label test could not be found?
Question: I have a project structure as
myApp/
apps/
tests/
__init__.py
tests.py
The `tests.py` looks as follows
from django.test import Te... |
Python: script to clean windows disk after % usage
Question: I created a python script for cleaning old files on a windows disk. Now I want
to improve that script and check if I went over a predefined disk usage and
then delete files ... how I can do it? Here's my code:
import os, time
path = r"... |
python: display elapsed time on shell
Question: When I run my Python script, there is some function that takes up to a few
minutes to complete, so I want to display on the shell some kind of timer that
informs the user on the time elapsed.
Is there any such thing already ready to use in Python?
Answer: One simplisti... |
Python MemoryError when storing saved lists
Question: I am new to python, so I apologize if this example is trivial.
I am trying to write a simple script that will pase and extract parts of two
large datafiles (~40gb each) into one resulting file with a slightly altered
format. I originally tried to use readlines(), b... |
Python - Facebook API - Need a working example
Question: Ok, so i've googled around, i've found threads here on stackoverflow and i've
checked the official Facebook wiki and.. and what not..
I now hope that one of you guys sits on a Facebook API sample code for Python.
This is what i've got so far and all i get is "In... |
matching headers in fasta files with python
Question: I have two files: the first is a fasta file with a header and sequence and the
second is composed of only headers.
File_1:
>DF94KKQ1|265|D0M1LACXX|3|2103|4637|10742|1|N|0|TGACCA
TTCCAAAGAAACATGGAAGACCCAGGACTTGGAGGCACCAGGCACCAGCACACAGGGGTA
GGC... |
Problems with Hangman in Pygame
Question: I'm trying to find out what is wrong with the folowing code:
import pygame, sys, random, linecache
from pygame.locals import *
#Start Pygame, define Pygame objects
pygame.init()
hangmanSurfaceObj = pygame.display.set_mode((640,480), 0)
cl... |
Connection appears accepted server-side but appears to be refused in my python script
Question: I have a python script I am running to add a document to a collection for a
remote mongodb database. The file is as follows:
from pymongo import Connection
ip = 'x.x.x.x' #edited out
conn = Co... |
issue converting python pandas DataFrame to R dataframe for use with rpy2
Question: I am having trouble converting a pandas DataFrame in Python to an R object,
for future use in R using rpy2.
The new pandas release 0.8.0 (released a few weeks ago) has a function to
convert pandas DataFrames to R DataFrames. The proble... |
multiprocessing.Process - Variable as function
Question: I am using the code below to parallelize the processing of a numpy array. The
target function in this case performs a simple linear stretch on the input
data. The array is segmented and then fed to the pool in chunks. This is
working quite well thanks to the nume... |
Django (or other pip package) in PyPy
Question: I am attempting to get django working using pypy. I have everything setup and
working great under python2.7 and python3.2 is not installed. I then installed
pypy and attempted to run django:
Traceback (most recent call last):
File "app_main.py", line ... |
Is it possible to use pyGTK and Monkeyrunner in same script?
Question: I started with importing GTK, and monkeyrunner:
from com.android.monkeyrunner import MonkeyRunner
import gtk
...
when I run this with monkeyrunner in the SDK tools, it says `ImportError: No
module named gtk`. When I run ... |
Runtime import with with multiple subdirectories in python
Question: what is the best way to perform this type of import in python
file to be imported which is available in location one/ne_one/one_two/"
fielname : two.py
def foo():
print "venkatttt!"
main file : main.py
s =... |
Layout of python code
Question: I'm trying to learn the best way to arrange/define code. Taking the below as
an example, I have to write the tkMessageBox command twice. I did try to
create a def within getText() and refer to that, but it didn't work.
Questions therefore please
1) How could I arrange the code such tha... |
Django nonrel development server doesn't import amazon.api
Question: I have a weird problem with Django nonrel's development server:
I have installed [Amazon Simple Product
API](https://github.com/yoavaviram/python-amazon-simple-product-api/ "Amazon
Simple Product API") , and it works fine in the shell, I can import i... |
Python - SQL Server call not using a transaction
Question: I have a simple Python script where I send in a call to a SQL Server 2008
stored procedure which in turn uses bcp through xp_cmdshell. When I call the
SP through management console, it works just fine. When I call it from the
python script, it hangs up as the e... |
askdirectory() changes focus to different window
Question: I am using Tkinter to build two windows. One the main one, pressing a button
leads to the creation of the second window.
This second window does not get focus immediately when it created. That I am
able to fix by calling .focus_force(). However, when I call th... |
Reproduce the Unix cat command in Python
Question: I am currently reproducing the following Unix command:
cat command.info fort.13 > command.fort.13
in Python with the following:
with open('command.fort.13', 'w') as outFile:
with open('fort.13', 'r') as fort13, open('command.in... |
Python/Django mime multipart email using boundary
Question: In Django(with python), how can I build an email that looks as follows:
What I need is an e-mail that starts with:
Content-Type: multipart/alternative;
boundary="=_5f8686714d769f9476ce778798b84ff4"
The boundary is the place to put pla... |
Retrieving outlook Contacts via python
Question: I am Trying to get Contacts out of `Outlook` using `Python`. The code is :
import win32com.client
import pywintypes
o = win32com.client.Dispatch("Outlook.Application")
ns = o.GetNamespace("MAPI")
profile = ns.Folders.Item("Outlook")
... |
How to Pass windows full title name with space using Pywinauto in python
Question: I wanted to automate Adobe Reader menus,
from pywinauto import application
app = application.Application()
app.start_(r"C:\Program Files (x86)\Adobe\Reader 9.0\Reader\AcroRd32.exe")
so after how to get comple... |
R fitdistr for Beta distribution: which starting parameters?
Question: I need to fit my data into a Beta distribution and retrieve the alpha
parameter. I'm trying to use R from python (rpy2) and my code looks like:
from rpy2 import *
from rpy2.robjects.packages import importr
MASS = importr('MASS... |
Python TCPServer
Question: I have a simple question.
When I create a python TCPServer for example using the example code :
import sys, SocketServer, os
from multiprocessing import Pool, Queue
class MyTCPHandler(SocketServer.BaseRequestHandler):
def handle(self):
... |
Load and show an image from the web in Python with Gtk 3?
Question: I'm writing an app on Ubuntu 12.04 with Python and GTK 3. The problem I have
is that I can't figure out how I should do to show a Gtk.Image in my app with
an image file from the web.
This is as far as I have come:
from gi.repository imp... |
Correct way to pause Python program
Question: I've been using the input function as a way to pause my scripts
print("something")
wait = input("PRESS ENTER TO CONTINUE.")
print("something")
is there a formal way to do this?
Answer: Seems fine to me (or `raw_input()` in Python 2.X). Alterna... |
Efficient method for getting elementwise types in Python/Pandas
Question: Following up on [a previous
question](http://stackoverflow.com/questions/11548005/numpy-or-pandas-keeping-
array-type-as-integer-while-having-a-nan-value), is there a preferred
efficient manner to get the type of each object within a column? This... |
CryptoJS and Pycrypto working together
Question: I'm encrypting a string in a web application using CryptoJS (v 2.3), and I
need to decrypt it on the server in Python, so I'm using PyCrypto. I feel like
I'm missing something because I can't can it working.
Here's the JS:
Crypto.AES.encrypt('123456789012... |
Integrating in Python using Sympy
Question: I am currently using `Sympy` to help me perform mathematical calculations.
Right now, I am trying to perform a numerical integration, but keep getting an
error any time I run the script. Here is the script:
from sympy import *
cst = { 'qe':1.60217646*10**-1... |
Can I bind multiple servers to the same TCP port?
Question: I would expect having multiple servers on the same port would cause problems.
In fact I want it to throw an exception when I try to start two servers on the
same port. The problem is, it seems more than happy to start multiple servers
on the same port. I can h... |
Which module should I import to use a PyHKEY?
Question: I'm attempting to win32api.RegLoadKey part of the pywin32 extension, however,
I am assuming I need to create a PyHKEY first. But I don't know which module
PyHKEY is in. The documentation is equally useless.
<http://docs.activestate.com/activepython/2.4/pywin32/PyH... |
VPython Install Issues
Question: I'm trying to import the visual module for 64-bit python. Unfortunately, I
keep getting the following error:
> ImportError: numpy.core.multiarray failed to import
>
> Traceback (most recent call last):
>
> File "C:\python\color_space.py", line 2, in
>
>
> from visual import ... |
Latitude and Longitude to Address
Question: I have about 8000 + Latitudes and Longitudes. I need to extract(reverse code),
them to location, possibly city.
Initially I checked with Google Maps, but according to their terms we should
not hit their services with our scripts.
Even the OpenStreetMaps doesnt allow us to h... |
matplotlib - control capstyle of line collection/large number of lines
Question: Similarly to a [previous
question](http://stackoverflow.com/questions/11312579/networkx-draw-networkx-
edges-capstyle) of mine, I'd like to control the capstyle of lines being drawn
using matplotlib. However, I have an extremely large numb... |
TypeError with PAMIE
Question: I am getting a TypeError with a very simple script on PAMIE, and I'm not sure
what I can do. I had found an answer suggesting that the library, `pywin32`
might not have set a `self` argument for this particular method
(`getElementsByTagName`) but I don't know for sure, as I don't know whe... |
Best Method to Find Multiple String Occurrences in Python
Question: I need to be pointed in the right direction for this problem I'm working on:
Let's say I'm reading output from a C program as follows:
while True:
ln = p.stdout.readline()
if '' == ln:
break
#do stuff... |
Copy a file line by line in python
Question: I am writing a python program to copy a file line by line into a new file. The
code I have is below in which I am using a loop to copy the file line by line.
However since the number of lines in the file may change, is there a way to
copy a file line by line in python witho... |
Ubuntu pass information to a text file during process execution
Question: My issue is that I have a function call it function1 which runs indefinitely.
The function itself echo's "hello" every 1 second. Using the command:
function1 >> temp.txt
Every 1 second if I am to view the file temp.txt I shou... |
SSL Connection Using .pem Certificate With Python
Question: I'm trying to establish successful communication over an HTTPS connection
using authentication. I'm using Python 2.7 w/ Django 1.4 on Ubuntu 12.04.
The API documentation I'm following has specific requirements for
authentication. Including the `Authentication... |
Django Installation Error :
Question: Trying to create the first project. First got the below error when I ran,
django-admin.py startproject mysite
then I tried,
django-admin.py
Also symlinked the path and its in the path. But I still get the error.
. . .
File "/Users/Satha/django-trunk/django/bin/django-admin.p... |
python subprocess as normal user
Question: I have a script that needs to be run as a super user:
$ sudo ./python-script.py
Within this script, I do some other things that _do not_ require super user
privileges.
$ os.mkdir('somefolder')
What is the best/most efficient way of cre... |
Is there a python json library can convert json to model objects, similar to google-gson?
Question: The standard python json module only can convert json string to dict
structures.
But I prefer to convert json to a model object strutures with their "parent-
child" relationship.
I use google-gson in Android apps but d... |
Python - how to create a random string 8 bytes long?
Question: > **Possible Duplicate:**
> [python random string generation with upper case letters and
> digits](http://stackoverflow.com/questions/2257441/python-random-string-
> generation-with-upper-case-letters-and-digits)
I need to create a random string that is... |
How can I further shorten this Python script which copies the contents of one file to another file?
Question: I'm reading Zed Shaw's "Learn Python The Hard Way". I'm up to exercise 17 (
<http://learnpythonthehardway.org/book/ex17.html> ) and hit the wall on extra
credit #'s 2 & 3\. Zed wants me to shorten the script by... |
Programmatically login to OKC
Question: I'm trying to programatically login to OKCupid
([www.okcupid.com/login](http://www.okcupid.com/login))in order to fetch
scrape some user data. I've tried to put together a python script to do this,
but seem to be doing something wrong.
The behavior I'd like from this sample scri... |
How can I display an image in Python 3 using tkinter/ttk?
Question: The nub of the matter is, what am I doing wrong in the following code snippet?
from tkinter import *
from tkinter.ttk import *
root = Tk()
myButton = Button(root)
myImage = PhotoImage(myButto... |
Importing matplotlib on Ubuntu
Question: So I downloaded and installed matplotlib. The weird things is that I can run
the examples fine when they were placed in home/user/Desktop but when I moved
them to home/user/Documents, they stopped working and I get the below message.
Is there something special about the Document... |
Youtube in Webkit/Python/GTK app
Question: I'm trying to do a python(2.7)/GTK+ app, and I have a window, containing a
WebKit WebView.
from gi.repository import Gtk, WebKit
class MainWindow:
def __init__( self ):
self.builder = Gtk.Builder()
self.builder.add_from_f... |
How to install and run pandas python library in Eclipse Juno?
Question: I am using pydev plugin in Eclipse Juno for my python programming in windows 7
and i am using python 3.2, it works fine while running python application
which using standard python packages. For my one of my project i have to use
pandas library, fo... |
Check if a directory exists in a zip file with Python
Question: Initially I was thinking of using `os.path.isdir` but I don't think this works
for zip files. Is there a way to peek into the zip file and verify that this
directory exists? I would like to prevent using `unzip -l "$@"` as much as
possible, but if that's t... |
Python SciPy FFT function - Input?
Question: I am currently writing some code which is supposed to perform FFT on a set of
data. I have a python list of points and I can easily create a time list. When
I run fft(datalist), I get the 'TypeError: 'numpy.ndarray' object is not
callable' error. I think (but please correct ... |
How to determine whether a year is a leap year in Python?
Question: I am trying to make a simple calculator to determine whether or not a certain
year is a leap year.
By definition, a leap year is divisible by four, but not by one hundred,
unless it is divisible by four hundred.
Here is my code:
def le... |
Python:Importing moduel Attribute Error,LPTHW ex47:
Question: I'm doing ex47 from Learn python the hard way[This is the
exercise](http://learnpythonthehardway.org/book/ex47.html) And this is my
code:
from nose.tools import*
from ex47.game import Room
def test_room():
gold = Room... |
Python MMTK "There is no program associated with ..pdb files, please install a suitable viewer"
Question: I'm new to programming and computer world. I'm trying to study biomolecular
simulations with MMTK.
I run it in Windows 7 and I have already installed this software:
* python-2.5.4
* numpy-1.6.2-win32-superpac... |
Use entire scope as input in plugin in Sublime Text 2
Question: One of the nice things about Textmate was the ability to pipe the contents of
an entire scope into a command, like so:
You could then specify the scope to be used, such as `meta.class.python` or
... |
Using Flask, trying to get AJAX to update a span after updating mongo record, but it's opening a new page
Question: Feel like I am stumbling over something fairly simple here.
I am not understanding something about AJAX and Flask.
I have a project wherein I display mongodb records in the browser, which has
been worki... |
Python: convert string to byte array
Question: Say that I have a 4 character string, and I want to convert this string into a
byte array where each character in the string is translated into its hex
equivalent. e.g.
str = "ABCD"
I'm trying to get my output to be
array('B', [41, 42, 4... |
Problems using etree in Python scraper
Question: I'm a newbie in Python looking to build a screen scraper in Scraperwiki but
I'm struggling with an error I can't work out how to fix. Essentially, I want
to parse an xml file but can't work out how to have my gp_indicators_scrape
function access the getroot() method.
Ca... |
Python Running an Excel Macro
Question: I am trying to use python to run an excel macro and then close excel. I have
the following:
import win32com.client
import os
xl = win32com.client.DispatchEx("Excel.Application")
wb = xl.workbooks.open("X:\Location\Location2\File1.xlsm")
xl... |
List integration as argument (beginner)
Question: I am writing a script in python, but I am a beginner (started yesterday).
Basically, I just create chunks that I fill with ~10 pictures, align them,
build the model, and build the texture. Now I have my chunks and I want to
align them...
From the [manual](http://downl... |
Is it possible to draw graphs on a given image using NetworkX?
Question: Is it possible to draw graphs on a given image (instead of on an empty figure)
by using the python package NetworkX?
Answer: Perhaps you can try this but it requires matplotlib:
import matplotlib.pyplot as plt
import matplotli... |
Python wrapper script to let a program be executed remotely with no blocking
Question: I am looking for a wrapper script to run a program which is called remotely by
a SSH command which terminates without waiting for the result of the program.
Here is my code:
#!/usr/bin/python
import sys
i... |
Python: change CWD of script bundled with py2app
Question: My script works fine when ran with `python`, but after I build it with
`py2app`, files and folders are created in `.app/Contents/Resources`. I use
`os.getcwd()` to find out where the script is located.
How can I fix this and make sure my files are created in t... |
__init__() takes at least 2 arguments (1 given) When Migrating using South with Custom Fields
Question: **i am new to south and i followed their documentation and after initializing
south migrations, after running**
manage.py migrate appname
**for the following custom models Models i added introspe... |
Python does not detect .pyc files
Question: I am using Python 3.2 (both for building and executing), and here is my
question.
I intend to ship my python application with the following setup:
There is a main script (say, `Main.py`), that is using a compiled module, say
`Module1.pyc`). To be precise, the directory stru... |
Best lightweight, responsive GUI framework Linux
Question: I've bought a Raspberry Pi, featuring a 300 Mhz CPU, but it does has a pretty
good GPU. It can even run XBMC. I want to program a GUI for it, which needs to
be responsive and good-looking, while taking optimal use of the hardware
available (which isn't too good... |
Getting docstrings from Python package __init__ - based imports
Question: I have several modules that are within a Python package:
# my_package contents
__init__.py
module1.py
module2.py
Within my `__init__.py`, I'm importing these modules so that they will be
accessible once the packag... |
Running wexpect on windows
Question: I have installed wexpect on windows7, now when i am trying to run any command,
i am getting below error. I am using MKS toolkit, so ls is a valid command.
>>> import pexpect
>>> pexpect.run('ls ')
Traceback (most recent call last):
File "<stdin>", line 1, ... |
Issue building cx_Oracle - libclntsh.so.11.1 => not found
Question: I'm trying to build cx_Oracle for a Python 2.7.2 and Oracle 11g installation
but the built cx_Oracle.so cannot find libclntsh.so.11.1 so importing
cx_Oracle in Python fails.
/mypath/cx_Oracle-5.1.1/build/lib.linux-x86_64-2.7-11g]$ ldd cx... |
python module resides in a repository whose name contains dash characters
Question: I know name of the module should not have a dash.
Here is my repository structure
my-repo-name/
src/
tests/
__init__.py
tests.py
fab/
__init__.py
... |
How can I step to use the python debugger to break at every function call?
Question: I want to closely monitor the chain of function calls which are called from a
certain function.
import pdb; pdb.set_trace()
res = api.InsertVideoEntry(video_entry, video)
I'm looking for a way to easily see tha... |
Python: Read from and write to a CSV file
Question: I am trying to read data from a CSV file (A), extract data, and write that to
a different CSV file (B). In the new file B, I want to have two columns.
Column 1 to list names of column 1 in file A and column 2 to list the count of
column 1 in file A. So for example, if... |
Eclipse unresolved external with geopy
Question:
import csv
from geopy import geocoders
import time
g = geocoders.Google()
spamReader = csv.reader(open('locations.csv', 'rb'), delimiter='\t', quotechar='|')
f = open("output.txt",'w')
for row in spamReader:
a = ', '.j... |
Is there a way to simulate python random.shuffle of a queue using a pseudorandom sequence or hash function?
Question: I'm building an application based around a task queue: it serves a series of
tasks to multiple, asynchronously connected clients. The twist is that the
**tasks must be served in a random order**.
My pr... |
Why doesn't PIL load locally while running Google App Engine Python 2.7 Mac OSX?
Question: I am using Google App engine on Mac OSX 10.7.4. When I load PIL from the
commandline, everything works fine. However, when I load it from the GAE local
environment, i.e.:
> import Image
Gives me the error:
> ImportError: No mo... |
Iteration of calendar.month_name can't be parsed by strptime()
Question: Here's something that seems a little silly: `datetime.strptime()` is happy to
accept an iterated list of month names when I just create a list by hand
(`months = ['January','February']`) but not when I iterate over a list of
months created by `cal... |
Subtract values in one list from corresponding values in another list - Python
Question: I have two lists:
A = [2, 4, 6, 8, 10]
B = [1, 3, 5, 7, 9]
How do I subtract each value in one list from the corresponding value in the
other list and create a list such that:
C = [1, 1, 1, 1... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.