code stringlengths 4 4.48k | docstring stringlengths 1 6.45k | _id stringlengths 24 24 |
|---|---|---|
def __init__(self, data, _id=None, session=None, date=None, source=None, destination=None): <NEW_LINE> <INDENT> if data is None: <NEW_LINE> <INDENT> data = '' <NEW_LINE> <DEDENT> self.data = data <NEW_LINE> self.session = session <NEW_LINE> if _id is None: <NEW_LINE> <INDENT> _id = uuid.uuid4() <NEW_LINE> <DEDENT> self... | :parameter data: the content of the message
:type data: a :class:`object`
:parameter _id: the unique identifier of the message
:type _id: :class:`uuid.UUID`
:keyword session: the session in which the message was captures
:type session: :class:`netzob.Common.Models.Vocabulary.Session.Session`
:parameter date: the timest... | 625941b3656771135c3eb622 |
def to_int(facts): <NEW_LINE> <INDENT> result = functools.reduce(lambda x, y: x * (y[0] ** y[1]), facts, 1) <NEW_LINE> return result | Assuming the input is a list of tuples of the form (p_i, a_i), this method
returns the scalar product (p_i ** a_i) * (p_j ** a_j) * ... | 625941b36aa9bd52df036b52 |
def set_disable_keyboard_on_lock(enable): <NEW_LINE> <INDENT> state = __utils__['mac_utils.validate_enabled'](enable) <NEW_LINE> cmd = 'systemsetup -setdisablekeyboardwhenenclosurelockisengaged ' '{0}'.format(state) <NEW_LINE> __utils__['mac_utils.execute_return_success'](cmd) <NEW_LINE> return __utils__['mac_... | Get whether or not the keyboard should be disabled when the X Serve
enclosure lock is engaged.
:param bool enable: True to enable, False to disable. "On" and "Off" are
also acceptable values. Additionally you can pass 1 and 0 to represent
True and False respectively
:return: True if successful, False if not
:... | 625941b3507cdc57c6306a81 |
def fetch_access_token(self, request_token=None, **kwargs): <NEW_LINE> <INDENT> with self._get_oauth_client() as client: <NEW_LINE> <INDENT> if request_token is None: <NEW_LINE> <INDENT> raise MissingRequestTokenError() <NEW_LINE> <DEDENT> token = {} <NEW_LINE> token.update(request_token) <NEW_LINE> token.update(kwargs... | Fetch access token in one step.
:param request_token: A previous request token for OAuth 1.
:param kwargs: Extra parameters to fetch access token.
:return: A token dict. | 625941b397e22403b379cd48 |
def set_captain(self) -> None: <NEW_LINE> <INDENT> self.print_players() <NEW_LINE> print("-"*50) <NEW_LINE> captain_nr = int(input("Write the shirt number of your upcoming captain: ")) <NEW_LINE> if self.team.set_captain(captain_nr) == False: <NEW_LINE> <INDENT> print("There isn't a player in the squad with nr: " + str... | Makes a player the team captain | 625941b394891a1f4081b858 |
def get_optimizer_param_groups_lr( model: OptimizerModelsType, base_lr: float, bias_lr_factor: float = 1.0, lr_multipliers_overwrite: Optional[Dict[str, float]] = None, ): <NEW_LINE> <INDENT> params: List[Dict[str, Any]] = [] <NEW_LINE> for ( module_name, _module, module_param_name, value, ) in iterate_module_named_par... | Allow setting up lr for modules
base_lr: lr for all modules
bias_lr_factor: scale factor for lr for bias term
lr_multipliers_overwrite (dict: str-> float):
Applying different lr multiplier to a set of parameters whose names
containing certain keys. For example, if lr_multipliers_overwrite={'backbone': 0.1},
... | 625941b3187af65679ca4ed5 |
@receiver(post_save, sender=User) <NEW_LINE> def create_notification_setting(sender, **kwargs): <NEW_LINE> <INDENT> if kwargs['created']: <NEW_LINE> <INDENT> NotificationSetting.objects.get_or_create(user=kwargs['instance']) | ユーザー作成時に空のnotification_settingも作成する | 625941b3baa26c4b54cb0ed4 |
def readData(self): <NEW_LINE> <INDENT> self.filepath = askopenfilename(parent=root, title="Choose data set!").__str__() <NEW_LINE> file = open(self.filepath,'r') <NEW_LINE> root.destroy() <NEW_LINE> strm1 = file.read().split('\n') <NEW_LINE> inData = np.zeros([4, len(strm1)-1]) <NEW_LINE> output = np.zeros([1, len(str... | doc strig | 625941b355399d3f05588463 |
def stripFormatting(s): <NEW_LINE> <INDENT> s = stripColor(s) <NEW_LINE> s = stripBold(s) <NEW_LINE> s = stripReverse(s) <NEW_LINE> s = stripUnderline(s) <NEW_LINE> s = stripItalic(s) <NEW_LINE> return s.replace('\x0f', '').replace('\x0F', '') | Returns the string s, with all formatting removed. | 625941b36fece00bbac2d4eb |
def _backpropagate(self, path, reward): <NEW_LINE> <INDENT> for node in reversed(path): <NEW_LINE> <INDENT> self.N[node] += 1 <NEW_LINE> self.Q[node] += reward | Send the reward back up to the ancestors of the leaf | 625941b345492302aab5e070 |
def test_dict(): <NEW_LINE> <INDENT> pass | Test C{dict} interface
>>> import gbp.git
>>> modifier = gbp.git.GitModifier('foo', 'bar', 1)
>>> sorted(modifier.keys())
['date', 'email', 'name']
>>> sorted(modifier.items())
[('date', '1 +0000'), ('email', 'bar'), ('name', 'foo')] | 625941b38c3a87329515816e |
@array <NEW_LINE> @score_10 <NEW_LINE> def pscore(detections, annotations, tolerance=PSCORE_TOLERANCE): <NEW_LINE> <INDENT> if len(annotations) < 2: <NEW_LINE> <INDENT> raise BeatIntervalError("At least 2 annotations are needed for" "P-Score.") <NEW_LINE> <DEDENT> if float(tolerance) <= 0: <NEW_LINE> <INDENT> raise Val... | Calculate the P-score accuracy for the given detections and annotations.
The P-score is determined by taking the sum of the cross-correlation
between two impulse trains, representing the detections and annotations
allowing for a tolerance of 20% of the median annotated interval [1]_.
Parameters
----------
detections ... | 625941b3b830903b967e96c9 |
def calculate_euclidean_distance(out_dir, ref_set, params, fit_type, datasets, subset=None): <NEW_LINE> <INDENT> euclidean_base_csv = 'euclidean_distances_from_{}_datasets_{}'.format(len(datasets), fit_type) <NEW_LINE> if subset is not None: <NEW_LINE> <INDENT> euclidean_base_csv = euclidean_base_csv.rsplit('.')[0] + s... | Calculates and store pairwise euclidean distances | 625941b37c178a314d6ef208 |
@log_func <NEW_LINE> def ProposeClassView(request): <NEW_LINE> <INDENT> if request.method == 'POST': <NEW_LINE> <INDENT> form = ClassProposalForm(request.POST) <NEW_LINE> user_message = UserMessage.objects.get_or_create( view='ProposeClassView', code="SUBMIT_SUCCESS", defaults={ 'summary': "Class Proposal Success", 'de... | Handle suggestions for classes from the great unwashed | 625941b3507cdc57c6306a82 |
def fileSyntaxCheck(fileInfo, timeoutInterval=20): <NEW_LINE> <INDENT> return hdlConvertor.parse(fileInfo.fileName, fileInfo.lang) | Perform syntax check on whole file | 625941b3046cf37aa974cafb |
def __init__(self, word_to_idx, mode='train', features_L=196,features_D=512, dim_embed=512, dim_hidden=1024, n_time_step=16, alpha_c=0.0, lstm_dropout_keep_prob=0.5): <NEW_LINE> <INDENT> assert mode in ["train", "eval"] <NEW_LINE> self.word_to_idx = word_to_idx <NEW_LINE> self.vocab_size = len(word_to_idx) <NEW_LINE> s... | Args:
word_to_idx: word-to-index mapping dictionary.
mode: train or evaluation
features_L, features_D: (optional) Dimension of vggnet19 conv5_3 feature vectors.
dim_embed: (optional) Dimension of word embedding.
dim_hidden: (optional) Dimension of all hidden state.
n_time_step: (optional) Time s... | 625941b37d43ff24873a2a54 |
def __init__(self, top, bot): <NEW_LINE> <INDENT> self.top = top <NEW_LINE> self.bot = bot | initializer for RationalFraction instance. top and bot are
Polynomial object representing numerator and denominator | 625941b391af0d3eaac9b7c3 |
def write_image_fluxes(self): <NEW_LINE> <INDENT> log.info("Writing image fluxes ...") <NEW_LINE> self.images_fluxes.saveto(self.images_fluxes_filepath) | This function ...
:return: | 625941b3d164cc6175782afe |
def InsertListCtrlItem(self, index, value, item): <NEW_LINE> <INDENT> i = self.__id(item) <NEW_LINE> some_long = self.InsertStringItem(index, value) <NEW_LINE> gItem = self.GetItem(index) <NEW_LINE> gItem.SetData(i) <NEW_LINE> self.SetItem(gItem) <NEW_LINE> return some_long | Insert an item to the list control giving it an internal id. | 625941b399cbb53fe6792998 |
def hash_password(plain_password): <NEW_LINE> <INDENT> return pwd_context.hash(plain_password) | Hash the password, using the pre-configured CryptContext. | 625941b32c8b7c6e89b3557c |
def get(self, key): <NEW_LINE> <INDENT> if key not in self.key_map: <NEW_LINE> <INDENT> return -1 <NEW_LINE> <DEDENT> else: <NEW_LINE> <INDENT> self.touch(key) <NEW_LINE> return self.val_map[key] | :type key: int
:rtype: int | 625941b330dc7b766590171c |
def unshift(self): <NEW_LINE> <INDENT> if self.begin is None: <NEW_LINE> <INDENT> firstvalue = None <NEW_LINE> <DEDENT> elif self.begin == self.end: <NEW_LINE> <INDENT> firstvalue = self.end.value <NEW_LINE> self.begin = None <NEW_LINE> self.end = None <NEW_LINE> <DEDENT> else: <NEW_LINE> <INDENT> firstvalue = self.beg... | Removes the first item (from begin) and returns it. | 625941b3d58c6744b4257a11 |
def datetime_to_seconds(dt): <NEW_LINE> <INDENT> return dt.timestamp() | Name this, just because its confusing. | 625941b3a4f1c619b28afdfc |
def is_bool(value: Union[str, bool]) -> bool: <NEW_LINE> <INDENT> return (value in true_list + false_list) or (isinstance(value, bool)) | validate whether the value is boolean | 625941b3cb5e8a47e48b7869 |
def create_carrier_proposed_assignment(self, **kwargs): <NEW_LINE> <INDENT> kwargs['_return_http_data_only'] = True <NEW_LINE> return self.create_carrier_proposed_assignment_with_http_info(**kwargs) | Create an assignment # noqa: E501
Creates a new assignment that a driver can later use. Each driver can only have one future assignment. **Submit Feedback**: Likes, dislikes, and API feature requests should be filed as feedback in our <a href="https://forms.gle/zkD4NCH7HjKb7mm69" target="_blank">API feedback form<... | 625941b3287bf620b61d3822 |
@celery.task(bind=True, ignore_results=True, base=AttributeManager) <NEW_LINE> def update_attributes(self: AttributeManager, app_name: str, user_id: str) -> None: <NEW_LINE> <INDENT> warnings.warn("This function will be removed. Use update_attributes_keep_result instead.", DeprecationWarning) <NEW_LINE> _update_attribu... | Task executing on the Celery worker service as an RPC called from
the different eduID applications.
:param self: base class
:param app_name: calling application name, like 'eduid_signup'
:param user_id: id for the user that has been updated by the calling application | 625941b301c39578d7e74bf5 |
def get_loaded_modules(): <NEW_LINE> <INDENT> return " ".join(os.environ.get("LOADEDMODULES", "").split(":")) | Returns a space separated list of loaded modules
These are modules loaded by the environment-modules system. This function
just looks in the LOADEDMODULES environment variable for the list. | 625941b3fff4ab517eb2f1e9 |
def filter_old_data(filename): <NEW_LINE> <INDENT> dataframe = pd.read_csv(filename) <NEW_LINE> to_remove = set([dt for dt in dataframe.date_and_time if flip_dates(dt) < deadline_time(6)]) <NEW_LINE> for dt in to_remove: dataframe = dataframe[dataframe.date_and_time != dt] <NEW_LINE> dataframe.to_csv(path_or_buf="serv... | Removes entries from the csv that occur before the threshhold date
:param filename: file to remove entries from | 625941b3eab8aa0e5d26d90f |
def plot_confusion_matrix(cm, classes, normalize=False, title='Confusion matrix', cmap=plt.cm.Blues): <NEW_LINE> <INDENT> if normalize: <NEW_LINE> <INDENT> cm = cm.astype('float') / cm.sum(axis=1)[:, np.newaxis] <NEW_LINE> print("Normalized confusion matrix") <NEW_LINE> <DEDENT> else: <NEW_LINE> <INDENT> print('Confusi... | This function prints and plots the confusion matrix.
Normalization can be applied by setting `normalize=True`.
Input
- cm : 计算出的混淆矩阵的值
- classes : 混淆矩阵中每一行每一列对应的列
- normalize : True:显示百分比, False:显示个数 | 625941b33539df3088e2e0fc |
def create_test_data(user=None): <NEW_LINE> <INDENT> SiteFactory() <NEW_LINE> UserFactory.create_batch(size=10) | Create test data. | 625941b394891a1f4081b859 |
def set_trigger(self): <NEW_LINE> <INDENT> ret = self.uEyeDll.is_SetExternalTrigger(self.cam, c_uint(IS_SET_TRIGGER_SOFTWARE)) <NEW_LINE> if ret == IS_SUCCESS: <NEW_LINE> <INDENT> self.logger.info("Successfully set software trigger") <NEW_LINE> <DEDENT> else: <NEW_LINE> <INDENT> self.logger.error("Failed to set softwar... | Wrapped call to set trigger type to software trigger. | 625941b3462c4b4f79d1d481 |
def split(l, idx): <NEW_LINE> <INDENT> if isinstance(idx, numbers.Integral): <NEW_LINE> <INDENT> idx = [idx] <NEW_LINE> <DEDENT> if idx: <NEW_LINE> <INDENT> idx = [0, *sorted(idx), len(l)] <NEW_LINE> for i, j in mit.pairwise(idx): <NEW_LINE> <INDENT> yield l[i:j] <NEW_LINE> <DEDENT> <DEDENT> else: <NEW_LINE> <INDENT> y... | Split a list into sub-lists at the given indices | 625941b3adb09d7d5db6c545 |
def test_generate_orphans_by_type_with_unit_keys(self): <NEW_LINE> <INDENT> unit_1 = gen_content_unit(PHONY_TYPE_1.id, self.content_root) <NEW_LINE> gen_content_unit(PHONY_TYPE_2.id, self.content_root) <NEW_LINE> results = list(self.orphan_manager.generate_orphans_by_type_with_unit_keys(PHONY_TYPE_1.id)) <NEW_LINE> sel... | Assert that orphans are retrieved by type with unit keys correctly | 625941b3ad47b63b2c509d3e |
def __init__(self, item): <NEW_LINE> <INDENT> self.__item = item <NEW_LINE> self.itemID = item.ID if item is not None else None <NEW_LINE> self.amount = 0 <NEW_LINE> self.__itemModifiedAttributes = ModifiedAttributeDict() <NEW_LINE> self.__itemModifiedAttributes.original = item.attributes <NEW_LINE> self.__itemModified... | Initialize cargo from the program | 625941b3b57a9660fec33630 |
def test_transcribe_dna_to_rna(): <NEW_LINE> <INDENT> assert 'GAUGGAACUUGACUACGUAAAUU' == transcribe_dna_to_rna('GATGGAACTTGACTACGTAAATT') | Test for transcribe_dna_to_rna. | 625941b38c0ade5d55d3e770 |
def endomorphism_ring(self, category=None): <NEW_LINE> <INDENT> try: <NEW_LINE> <INDENT> return self.__endomorphism_ring <NEW_LINE> <DEDENT> except AttributeError: <NEW_LINE> <INDENT> pass <NEW_LINE> <DEDENT> self.__endomorphism_ring = homspace.EndomorphismSubring(self, category=category) <NEW_LINE> return self.__endom... | Return the endomorphism ring of self.
OUTPUT: b = self.sturm_bound()
EXAMPLES: We compute a few endomorphism rings::
sage: from sage_modabvar import J0
sage: J0(11).endomorphism_ring()
Endomorphism ring of Abelian variety J0(11) of dimension 1
sage: J0(37).endomorphism_ring()
Endomorphism ring of... | 625941b3097d151d1a222c15 |
def num_processes(tree, fn): <NEW_LINE> <INDENT> c = Counter() <NEW_LINE> for proc in tree.iter('process'): <NEW_LINE> <INDENT> c['num_processes'] += 1 <NEW_LINE> <DEDENT> return c | gets the number of processes in the exe | 625941b3a79ad161976cbef7 |
def is_valid_type(self, filepath): <NEW_LINE> <INDENT> if len(self._validators) == 0: <NEW_LINE> <INDENT> validators = [self.default_validator, self.not_repo] <NEW_LINE> <DEDENT> else: <NEW_LINE> <INDENT> validators = self._validators + [self.not_repo] <NEW_LINE> <DEDENT> for validator in validators: <NEW_LINE> <INDENT... | Returns True if the given filepath is a valid watchable filetype.
The filepath can be assumed to be a file (not a directory). | 625941b36e29344779a623c9 |
def getShortDescription(self, test, room): <NEW_LINE> <INDENT> room -= 1 <NEW_LINE> s = str(test) <NEW_LINE> if len(s) > room: <NEW_LINE> <INDENT> pos = s.find(" (") <NEW_LINE> if pos >= 0: <NEW_LINE> <INDENT> w = room - (pos + 5) <NEW_LINE> if w < 1: <NEW_LINE> <INDENT> s = s[:room-3] + "..." <NEW_LINE> <DEDENT> else:... | Return a description of a test that fits in ``room`` characters. | 625941b34e696a04525c9207 |
def consume_attribute_type_information(line: str) -> Tuple[Optional[str], Optional[Tuple[Union[str, List[str]]]], str]: <NEW_LINE> <INDENT> attribute_type, line = consume(line, ATTRIBUTE_TYPE_PATTERN) <NEW_LINE> if attribute_type is None: <NEW_LINE> <INDENT> return None, None, line <NEW_LINE> <DEDENT> additional... | Extracts the type of an attribute from the beginning of a line.
:param line: The line to extract the attribute type from.
:return: The attribute type, any additional type information, and the remainder of the line. | 625941b30383005118ecf396 |
def parse_ggt_format(data_dir): <NEW_LINE> <INDENT> gt_fnames = glob.glob(osp.join(data_dir,'*.json')) <NEW_LINE> id_match = re.compile('.*?([\d]+_*[\d]*).*') <NEW_LINE> gt = {} <NEW_LINE> for gt_fn in gt_fnames: <NEW_LINE> <INDENT> im_id = id_match.match(osp.basename(gt_fn)).groups()[0] <NEW_LINE> gt_dat = [] <NEW_LIN... | Parses Google OCR json and returns the
ground-truth in standard format:
image-id --> [5xn, [text_1,text_2,..., text_n]] dict.
Where 5xn is a matrix for n boxes, with first four
numbers being x,y,w,h and the 5th being the "score". | 625941b3e5267d203edcda53 |
def __pingBack(ircMsg): <NEW_LINE> <INDENT> commands = [] <NEW_LINE> nick = ircMsg.net.findNick(ircMsg.src) <NEW_LINE> if nick.pingOut > 0: <NEW_LINE> <INDENT> lagTime = time.time() - nick.pingOut <NEW_LINE> lagTime = round(lagTime, 4) <NEW_LINE> commands.append( "PRIVMSG " + nick.pingDest + " :Your current ping is " +... | Processes a return ping, relays the lag back. | 625941b326238365f5f0ec1a |
def get_or_compute_grads(loss_or_grads, params): <NEW_LINE> <INDENT> if any(not isinstance(p, theano.compile.SharedVariable) for p in params): <NEW_LINE> <INDENT> raise ValueError("params must contain shared variables only. If it " "contains arbitrary parameter expressions, then " "lasagne.utils.collect_shared_vars() m... | Helper function returning a list of gradients
Parameters
----------
loss_or_grads : symbolic expression or list of expressions
A scalar loss expression, or a list of gradient expressions
params : list of shared variables
The variables to return the gradients for
Returns
-------
list of expressions
If `los... | 625941b3dd821e528d63af63 |
def postproc(self): <NEW_LINE> <INDENT> return True | post-processing | 625941b35f7d997b8717484d |
def __init__(self, data=None, local_vars_configuration=None): <NEW_LINE> <INDENT> if local_vars_configuration is None: <NEW_LINE> <INDENT> local_vars_configuration = Configuration.get_default_copy() <NEW_LINE> <DEDENT> self.local_vars_configuration = local_vars_configuration <NEW_LINE> self._data = None <NEW_LINE> self... | GetLiveStreamPlaybackIDResponse - a model defined in OpenAPI | 625941b34527f215b584c214 |
def __init__(self, primary_smtp_address, fullname=None, access_type=None, autodiscover=False, credentials=None, config=None, locale=None, default_timezone=None): <NEW_LINE> <INDENT> if '@' not in primary_smtp_address: <NEW_LINE> <INDENT> raise ValueError("primary_smtp_address '%s' is not an email address" % primary_smt... | :param primary_smtp_address: The primary email address associated with the account on the Exchange server
:param fullname: The full name of the account. Optional.
:param access_type: The access type granted to 'credentials' for this account. Valid options are 'delegate'
(default) and 'impersonation'.
:param autodiscove... | 625941b3507cdc57c6306a83 |
def _getRoutingSrcPortDst(self, G): <NEW_LINE> <INDENT> node_port_dst = {} <NEW_LINE> for node in G: <NEW_LINE> <INDENT> port_dst = {} <NEW_LINE> node_port_dst[node] = port_dst <NEW_LINE> for destination in G[node].keys(): <NEW_LINE> <INDENT> port = G[node][destination][0]['port'] <NEW_LINE> node_port_dst[node][port] =... | Return a dictionary of dictionaries with the format:
node_port_dst[node][port] = next_node
Parameters
----------
G : TYPE
DESCRIPTION.
Returns
-------
None. | 625941b38da39b475bd64d28 |
def reverse(dim, R): <NEW_LINE> <INDENT> p = numpy.zeros(dim*(dim+1)/2) <NEW_LINE> k=0 <NEW_LINE> for i in range(dim): <NEW_LINE> <INDENT> for j in range(0,i+1): <NEW_LINE> <INDENT> p[k] = R[i,j] <NEW_LINE> k +=1 <NEW_LINE> <DEDENT> <DEDENT> return p | Transforms a symmetric matrix into a vector containig the lower triangle
:param R: the symmetric matrix
:return: the vector | 625941b3596a89723608987d |
def test_multiple(labels, decisions, tests=('ztest', 'fisher', 'chi2', 'BF', 'prop'), display=False): <NEW_LINE> <INDENT> decisions = boolean_array(decisions) <NEW_LINE> crosstab = pd.crosstab(pd.Series(labels), pd.Series(decisions)) <NEW_LINE> crosstab = crosstab.values <NEW_LINE> tb_crosstab = top_bottom_crosstab(lab... | Function that returns p_values for z-score, fisher exact, and chi2 test
of 2x2 crosstab of passing rate by labels and decisions
See docs for z_test_ctabs, fisher_exact, chi2_contingency and
bf_ctabs for details of specific tests
Parameters
----------
labels : array_like
categorical labels for each corresponding v... | 625941b385dfad0860c3ac0a |
def predict_trajectory(x_init, v, y, config): <NEW_LINE> <INDENT> x = np.array(x_init) <NEW_LINE> traj = np.array(x) <NEW_LINE> time = 0 <NEW_LINE> while time <= config.predict_time: <NEW_LINE> <INDENT> x = motion(x, [v, y], config.dt) <NEW_LINE> traj = np.vstack((traj, x)) <NEW_LINE> time += config.dt <NEW_LINE> <DEDE... | predict trajectory with an input
轨迹产生的原理是，利用motion函数，基于当前机器人的状态x，在未来一段时间内(predict_time)产生一串状态x的序列 | 625941b394891a1f4081b85a |
def single_view(self,request): <NEW_LINE> <INDENT> if request.method == 'GET': <NEW_LINE> <INDENT> form = SingleModelForm() <NEW_LINE> return render(request,'single_view.html',{'form':form}) <NEW_LINE> <DEDENT> else: <NEW_LINE> <INDENT> form = SingleModelForm(request.POST) <NEW_LINE> if form.is_valid(): <NEW_LINE> <IND... | 单条录入
:param request:
:return: | 625941b360cbc95b062c62fb |
def addCounts(countDict, fname): <NEW_LINE> <INDENT> logging.debug("Parsing %s" % fname) <NEW_LINE> for line in open(fname): <NEW_LINE> <INDENT> line = line.strip() <NEW_LINE> fields = line.split("\t") <NEW_LINE> if len(fields)!=2: <NEW_LINE> <INDENT> logging.error("Count line %s does not contain two fields" % repr(lin... | parse line of file with format <id>tab<count>, add counts to dict, return dict | 625941b3187af65679ca4ed7 |
def has_in(self): <NEW_LINE> <INDENT> return self._idx < len(self.stdin) | Return true if input queue has data | 625941b3baa26c4b54cb0ed6 |
def file2groupname(filename, slen=5, symtable=None): <NEW_LINE> <INDENT> def randstr(n): <NEW_LINE> <INDENT> return ''.join([chr(random.randint(97, 122)) for i in range(n)]) <NEW_LINE> <DEDENT> gname = fix_varname(filename).lower() + randstr(slen) <NEW_LINE> if '_' in gname: <NEW_LINE> <INDENT> gname = gname.replace('... | create a group name based of filename
the group name will have a string component of
length slen followed by a 4 digit number
Arguments
---------
filename (str) filename to use
slen (int) length of string portion (default 5)
symtable (None or larch symbol table) symbol table for
checking that the gr... | 625941b30a50d4780f666c41 |
def create_sriov_logicalport(self, ip, logicalpartition_uuid, x_api_session): <NEW_LINE> <INDENT> log.log_debug("starting SRIOV LogicalPort creation") <NEW_LINE> header_object = HmcHeaders.HmcHeaders("web") <NEW_LINE> ns = header_object.ns["xmlns"] <NEW_LINE> sriov_logical_port_object = UOM.SRIOVEthernetLogicalPort() <... | Creates SRIOV Logical Port for a given LogicaPartition
Args:
ip:ip address of hmc
logicalpartition_uuid : UUID of partition the LoicalPort to be created
x_api_session :session to be used | 625941b363b5f9789fde6e97 |
@app.route("/register", methods=["GET", "POST"]) <NEW_LINE> def register(): <NEW_LINE> <INDENT> if request.method == "POST": <NEW_LINE> <INDENT> if request.form.get("password") != request.form.get("confirm-password"): <NEW_LINE> <INDENT> return render_template("register.html", nomatch=1) <NEW_LINE> <DEDENT> rows = db.e... | Register user | 625941b338b623060ff0aba8 |
def loss(self, logits, labels): <NEW_LINE> <INDENT> with tf.name_scope('loss'): <NEW_LINE> <INDENT> logits = tf.reshape(logits, (-1, 2)) <NEW_LINE> shape = [logits.get_shape()[0], 2] <NEW_LINE> epsilon = tf.constant(value=1e-8, shape=shape) <NEW_LINE> logits = logits + epsilon <NEW_LINE> labels = tf.to_float(tf.reshape... | Calculates the loss from the logits and the labels.
Args:
logits: Logits tensor, float - [batch_size, 2].
labels: Labels tensor, int32 - [batch_size, 2].
Returns:
loss: Loss tensor of type float. | 625941b36fece00bbac2d4ed |
def register_observation(self, obs: Observation): <NEW_LINE> <INDENT> obs.client = self._client <NEW_LINE> lbl_len = len(obs.labels) <NEW_LINE> obs_space_len = len(obs.observation_space.low) <NEW_LINE> obs_len = obs.compute().size <NEW_LINE> if lbl_len != obs_space_len: <NEW_LINE> <INDENT> raise ValueError('Labels have... | Add an observation to be computed.
Args:
obs (Observation): Observation to be tracked. | 625941b3dc8b845886cb52e6 |
def _select_polarization (self,value): <NEW_LINE> <INDENT> self.ms_corr_names = value.split(" "); <NEW_LINE> ncorr = len(self.ms_corr_names); <NEW_LINE> if ncorr < 2: <NEW_LINE> <INDENT> corrlist = [self._corr_1, self._corr_1_2x2]; <NEW_LINE> <DEDENT> elif ncorr < 4: <NEW_LINE> <INDENT> corrlist = [self._corr_2,self._c... | Called when the polarization representation is selected | 625941b345492302aab5e072 |
def get_item_type(self, xml_str: bytes): <NEW_LINE> <INDENT> root = Etree.fromstring(xml_str) <NEW_LINE> for x in root.findall('entry'): <NEW_LINE> <INDENT> if x.get('key') == "type": <NEW_LINE> <INDENT> raw_type = x.text <NEW_LINE> <DEDENT> <DEDENT> if raw_type in SUPPORTED_ELEMENT_TYPES: <NEW_LINE> <INDENT> if raw_ty... | Get the item type.
Args:
xml_str (bytes): The XML content for item info.
Returns:
str: The type name. | 625941b3b7558d58953c4ccf |
def get_params(self): <NEW_LINE> <INDENT> return self._params | Returns the DecentParams structure which originated these results. | 625941b3be7bc26dc91cd3b9 |
def fit(self, X, y=None): <NEW_LINE> <INDENT> return self | Could add a method here to fill in pixels with surrounding median
so that the model could pick up digits that are thinner | 625941b3b830903b967e96cb |
def get_parent(self): <NEW_LINE> <INDENT> return self.__parent | Gets the scope's parent scope.
:return: The current scope's parent scope. | 625941b38e7ae83300e4ad7f |
def ahead(ant): <NEW_LINE> <INDENT> return neighbor(ant, ant.direction) | Gets the ant's ahead neighbor. | 625941b366673b3332b91e49 |
def list_mountables(self): <NEW_LINE> <INDENT> self.output.info('Mountable overlays:') <NEW_LINE> self.output.info('~~~~~~~~~~~~~~~~~~~') <NEW_LINE> if self.mountables: <NEW_LINE> <INDENT> for ovl in sorted(self.mountables): <NEW_LINE> <INDENT> self.output.info(ovl) <NEW_LINE> <DEDENT> <DEDENT> else: <NEW_LINE> <INDENT... | Lists all overlays that can be mounted. | 625941b37047854f462a11c0 |
def runZlib(WRS, compressLevel = 6): <NEW_LINE> <INDENT> if WRS.compresslevel: compressLevel = WRS.compresslevel <NEW_LINE> useTimer = perf_counter() <NEW_LINE> writeTimer = perf_counter() <NEW_LINE> with open(WRS.fileName, 'wb') as f: <NEW_LINE> <INDENT> f.write(zlib.compress(bytes(json.dumps(data), encoding="ascii"),... | json zlib | 625941b3d268445f265b4c27 |
def test_ContactHandler_read_filter_id(self): <NEW_LINE> <INDENT> handler = ContactHandler <NEW_LINE> type = 'read' <NEW_LINE> test_data = ( ('?id=1&id=2', {}, 'populated_list', 2), ('?id=1', {}, 'populated_list', 1), ('?id=', {}, 'unprocessable', 1), ('?id=&id=1&id=2', {}, 'unprocessable', 1), ('?id=lalalala',... | Plural DELETE request, applying the filter ``id``. | 625941b3f7d966606f6a9dbb |
def _get_as_dict(self, resource_id, fields=None, os_ironic_api_version=None, global_request_id=None): <NEW_LINE> <INDENT> resource = self._get(resource_id, fields=fields, os_ironic_api_version=os_ironic_api_version, global_request_id=global_request_id) <NEW_LINE> if resource: <NEW_LINE> <INDENT> return resource.to_dict... | Retrieve a resource as a dictionary
:param resource_id: Identifier of the resource.
:param fields: List of specific fields to be returned.
:param os_ironic_api_version: String version (e.g. "1.35") to use for
the request. If not specified, the client's default is used.
:param global_request_id: String containing ... | 625941b31b99ca400220a862 |
def search_hashtag(self, hashtag): <NEW_LINE> <INDENT> search_hashtag = f'#{hashtag} -filter:retweets' <NEW_LINE> client = self.API() <NEW_LINE> numTweets = 100 <NEW_LINE> distinct_hashtags = collections.defaultdict(int) <NEW_LINE> for tweet in tweepy.Cursor(client.search, q=search_hashtag, tweet_mode='extended').items... | Print hashtags and the number of their occurences in the first 100 tweets with specified hashtag | 625941b3956e5f7376d70c2f |
def object_info(self, oname, detail_level=0): <NEW_LINE> <INDENT> content = dict(oname=oname, detail_level=detail_level) <NEW_LINE> msg = self.session.msg('object_info_request', content) <NEW_LINE> self._queue_send(msg) <NEW_LINE> return msg['header']['msg_id'] | Get metadata information about an object.
Parameters
----------
oname : str
A string specifying the object name.
detail_level : int, optional
The level of detail for the introspection (0-2)
Returns
-------
The msg_id of the message sent. | 625941b363b5f9789fde6e98 |
def _finite_field_ext_pari_(self): <NEW_LINE> <INDENT> f = self.polynomial() <NEW_LINE> return FiniteField_ext_pari(self.order(), self.variable_name(), f) | Return a :class:`FiniteField_ext_pari` isomorphic to ``self`` with
the same defining polynomial.
.. NOTE::
This method will vanish eventually because that implementation of
finite fields will be deprecated.
EXAMPLES::
sage: k.<a> = GF(2^20)
sage: kP = k._finite_field_ext_pari_()
sage: kP
Fin... | 625941b3f8510a7c17cf94b8 |
def get_samples_from_labels(self, labels, trials=5): <NEW_LINE> <INDENT> clamped = np.ones(labels.shape, dtype=np.float32) <NEW_LINE> data = self.get_samples([(self.label_idx, labels)], walkback=self.calc_walkback(trials), indices=[self.input_idx], clamped=[clamped], symbolic=False) <NEW_LINE> return np.array(data)[:, ... | Clamps labels and generates samples.
Parameters
----------
labels : WRITEME
trials : WRITEME | 625941b3d18da76e23532283 |
def delete_blocked_domain_with_http_info(self, domain, **kwargs): <NEW_LINE> <INDENT> all_params = ['domain'] <NEW_LINE> all_params.append('async_req') <NEW_LINE> all_params.append('_return_http_data_only') <NEW_LINE> all_params.append('_preload_content') <NEW_LINE> all_params.append('_request_timeout') <NEW_LINE> para... | Unblock an existing domain from the list of blocked domains # noqa: E501
Unblocks an existing domain from the list of blocked domains # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.delete_blocked_domain_with_http... | 625941b3046cf37aa974cafe |
def fit(self,X,y): <NEW_LINE> <INDENT> X, y = check_X_y(X, y, accept_sparse = None, dtype=np.float64) <NEW_LINE> if self.normalize: <NEW_LINE> <INDENT> self._x_mean = np.mean(X,0) <NEW_LINE> self._x_std = np.std(X,0) <NEW_LINE> X = (X - self._x_mean) / self._x_std <NEW_LINE> <DEDENT> if self.fit_intercept: ... | Fits Logistic Regression with ARD
Parameters
----------
X: array-like of size [n_samples, n_features]
Training data, matrix of explanatory variables
y: array-like of size [n_samples]
Target values
Returns
-------
self : object
Returns self. | 625941b32c8b7c6e89b3557e |
def save(self): <NEW_LINE> <INDENT> self.send('save') | Save current parameters in non-volatile memory. | 625941b34f6381625f1147f9 |
def connect( self, resource_group_name, resource_provider_namespace, parent_resource_type, parent_resource, serial_port, **kwargs ): <NEW_LINE> <INDENT> cls = kwargs.pop('cls', None) <NEW_LINE> error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } <NEW_LINE> error_map.upda... | Connect to serial port of the target resource.
:param resource_group_name: The name of the resource group.
:type resource_group_name: str
:param resource_provider_namespace: The namespace of the resource provider.
:type resource_provider_namespace: str
:param parent_resource_type: The resource type of the parent resou... | 625941b37b180e01f3dc45bb |
def get_mem_usage(pid): <NEW_LINE> <INDENT> mem = {} <NEW_LINE> pid_status_path='/proc/%s/status'%pid <NEW_LINE> with open(pid_status_path) as f: <NEW_LINE> <INDENT> for line in f: <NEW_LINE> <INDENT> mem[line.split(':')[0]] = line.split(':')[1].strip() <NEW_LINE> <DEDENT> <DEDENT> return mem | 得到进程的pid号，查看/proc/pid/status文件，格式如下
VmPeak: 23836 kB
VmSize: 23796 kB
VmLck: 0 kB
VmHWM: 2012 kB
VmRSS: 2012 kB
VmData: 680 kB
VmStk: 88 kB
VmExe: 116 kB
VmLib: 2356 kB
然后将其放到字典中，以：为分隔第一列是key，第二列是value，最后函数返回字典mem | 625941b3c432627299f049fa |
def cal_cost(self, X, groups): <NEW_LINE> <INDENT> k = self.k <NEW_LINE> total_cost = 0. <NEW_LINE> for i in xrange(k): <NEW_LINE> <INDENT> idx = np.where(groups == i) <NEW_LINE> group_X = X[idx, :] <NEW_LINE> diff = group_X - self.centers[i, :] <NEW_LINE> cost = np.power(diff, 2).sum() <NEW_LINE> total_cost += cost <N... | return cost of all clusters | 625941b316aa5153ce36222b |
def flatten_SIF(data): <NEW_LINE> <INDENT> result = np.zeros(data[0].shape) + 2 <NEW_LINE> for z in range(data.shape[0]): <NEW_LINE> <INDENT> mask = result == 2 <NEW_LINE> result[mask] = data[z][mask] <NEW_LINE> <DEDENT> return result.astype(int) | Color of pixel is the first non-transparent layer.
0=black, 1=white, 2=transparent | 625941b33346ee7daa2b2b1b |
def create_mlb_target(self, target): <NEW_LINE> <INDENT> target = spotinst_mlb.TargetRequest(target) <NEW_LINE> excluded_group_dict = self.exclude_missing(json.loads(target.toJSON())) <NEW_LINE> formatted_group_dict = self.convert_json( excluded_group_dict, self.underscore_to_camel) <NEW_LINE> body_json = json.dumps(fo... | Create MLB target
# Arguments
target (Target): Target Object
# Returns
(Object): Spotinst API response | 625941b32ae34c7f2600cee4 |
def __init__(self): <NEW_LINE> <INDENT> with open('authorizer_rules.yaml') as rules_file: <NEW_LINE> <INDENT> self._rules = yaml.load(rules_file) | Initialise the authorizer by loading the rules file | 625941b356ac1b37e6263f94 |
def test_flatten_by_keys_validList(): <NEW_LINE> <INDENT> flattened = flatten_by_keys(FORECAST, keys=['city', 'coord.lat']) <NEW_LINE> assert flattened == {'city': 'jacksonville', 'coord.lat': 30.332} | GIVEN a json-serialzed document converted to a python dict
WHEN the user requests to flatten and specifies a list of keys
THEN assert it flattens only the specified keys | 625941b32ae34c7f2600cee5 |
def spikeGet(t,v,vT=None): <NEW_LINE> <INDENT> if vT == None: <NEW_LINE> <INDENT> vT = [(0.75*(np.max(v)-np.sqrt(np.std(v)))), 10] <NEW_LINE> vT = np.max(vT) <NEW_LINE> <DEDENT> vTF = v>vT <NEW_LINE> idx = np.nonzero((vTF[:-1]==0) & (vTF[1:]==1)) <NEW_LINE> return t[idx[0]+1] | Extract spike time using boolean logic. Seperate array at T/F
order offset one place, compare and detect.
Args:
t: numpy time array
v: numpy voltage array
vT = voltage threshold (optional)
Returns:
firing rate of neuron | 625941b3fff4ab517eb2f1eb |
def deducirajPobjednika (konacni_rezultat): <NEW_LINE> <INDENT> pobjednik = [0] <NEW_LINE> for i in range(1, len(konacni_rezultat)): <NEW_LINE> <INDENT> if konacni_rezultat[i] > konacni_rezultat[pobjednik[0]]: <NEW_LINE> <INDENT> pobjednik = [i] <NEW_LINE> <DEDENT> elif konacni_rezultat[i] == konacni_rezultat[pobjednik... | Otkrij tko je skupio strogo najvise bodova.
Argument funkcije mora biti povratna vrijednost funkcije
Tablic.Log.konacniRezultat iz koje se trazi indeks igraca sa strogo
najvecim brojem skupljenih bodova. Ako vise igraca dijeli prvo mjesto,
povratna vrijednost je uzlazno sortirani tuple njihovih indeksa. | 625941b3627d3e7fe0d68c01 |
def _get_name_for_type(self, type_value): <NEW_LINE> <INDENT> datadict = json.loads(self.instance.xform.json) <NEW_LINE> for item in datadict['children']: <NEW_LINE> <INDENT> if type(item) == dict and item.get('type') == type_value: <NEW_LINE> <INDENT> return item['name'] | We cannot assume that start time and end times always use the same
XPath. This is causing problems for other peoples' forms.
This is a quick fix to determine from the original XLSForm's JSON
representation what the 'name' was for a given
type_value ('start' or 'end') | 625941b3ab23a570cc24ff3a |
def sign(self, request, consumer, token): <NEW_LINE> <INDENT> key, raw = self.signing_base(request, consumer, token) <NEW_LINE> hashed = hmac.new(key, raw, sha) <NEW_LINE> return binascii.b2a_base64(hashed.digest())[:-1] | Builds the base signature string. | 625941b324f1403a92600925 |
def _get_env_vars(self): <NEW_LINE> <INDENT> env_vars = {} <NEW_LINE> if self.auth_token: <NEW_LINE> <INDENT> env_vars['st2_auth_token'] = self.auth_token.token <NEW_LINE> <DEDENT> if self._env: <NEW_LINE> <INDENT> env_vars.update(self._env) <NEW_LINE> <DEDENT> return env_vars | :rtype: ``dict`` | 625941b321a7993f00bc7a9b |
def fit(self, examples, min_word_count=10, min_char_count=100, num_chars_per_word=16): <NEW_LINE> <INDENT> tokenized_examples = [ _tokenize(example, self._tokenizer, num_chars_per_word) for example in tqdm(examples, 'tokenizing') ] <NEW_LINE> word_counter = _get_word_counter(tokenized_examples) <NEW_LINE> char_counter ... | Fits examples and return indexed examples with metadata.
Fitting examples means the vocab is created out of the examples.
The vocab can be saved via `save` and loaded via `load` methods.
Args:
examples: list of dictionary, where each dictionary is an example.
min_word_count: `int` value, minimum word count to be ... | 625941b3d58c6744b4257a14 |
def download_playlist(db: DBMuziek, name: str): <NEW_LINE> <INDENT> playlist_query = db.get_playlist(name) <NEW_LINE> if not playlist_query: <NEW_LINE> <INDENT> print(f"The playlist {name} doesn't exist.") <NEW_LINE> return <NEW_LINE> <DEDENT> songs = db.get_playlist_songs(playlist_query["playlist_id"]) <NEW_LINE> if n... | Downloads the playlist requested based on the urls stored in the database.
:author: Carlos
:param db: The database used.
:param name: Name of the playlist to download.
:PRE: The database object needs to be connected.
:POST: All the songs in the playlist are downloaded | 625941b3fff4ab517eb2f1ec |
@app.route('/') <NEW_LINE> def viz_page(): <NEW_LINE> <INDENT> return flask.render_template("nmf_demo.html") | Homepage: serve our visualization page, awesome.html | 625941b394891a1f4081b85b |
def __init__(self, **specs): <NEW_LINE> <INDENT> BackgroundSources.__init__(self, **specs) | Constructor for class GalaxiesFaintStars | 625941b3099cdd3c635f0a10 |
def set_params(self, params): <NEW_LINE> <INDENT> pass | Set parameters from an array, using the same ordering as the list
returned by self.params(). | 625941b30a366e3fb873e5c9 |
def _hm_event_callback(self, device, caller, attribute, value): <NEW_LINE> <INDENT> _LOGGER.debug("%s received event '%s' value: %s", self._name, attribute, value) <NEW_LINE> has_changed = False <NEW_LINE> if attribute in self._data: <NEW_LINE> <INDENT> if self._data[attribute] != value: <NEW_LINE> <INDENT> self._data[... | Handle all pyhomematic device events. | 625941b31f5feb6acb0c4910 |
def from_labelling_and_area_sequence(L, D): <NEW_LINE> <INDENT> return ParkingFunction_class([L.index(i)+1-D[L.index(i)] for i in range(1,len(L)+1)]) | Returns the parking function corresponding to the labelling area sequence pair.
INPUT:
- ``L`` -- a labelling permutation
- ``D`` -- an area sequence for a Dyck word
OUTPUT:
- returns the parking function corresponding the labelling permutation ``L``
and ``D`` an area sequence of the corresponding Dyck path
EXA... | 625941b331939e2706e4cc25 |
def add_neighbor(self, vertex_obj, weight): <NEW_LINE> <INDENT> self.neighbors_dict[vertex_obj.__id] = (vertex_obj, weight) <NEW_LINE> return self.neighbors_dict | Add a neighbor along a weighted edge by storing it in the neighbors dictionary.
Parameters:
vertex_obj (Vertex): An instance of Vertex to be stored as a neighbor.
weight (int): The edge weight from self -> neighbor. | 625941b36aa9bd52df036b55 |
def hostRoles(opt): <NEW_LINE> <INDENT> return hostFact(opt.role_fact, opt) | Return a dict matching hostnames and system roles (as selected via
role_fact). | 625941b3d7e4931a7ee9dccf |
def __get_block(self, block_hash): <NEW_LINE> <INDENT> sql = 'SELECT * FROM block WHERE hash = "{}";'.format(block_hash) <NEW_LINE> return self.__query(sql) | Retrieves a block from the database with a hash.
| 625941b3a05bb46b383ec5e1 |
def get_subcategory(self, id, **data): <NEW_LINE> <INDENT> return self.get("/subcategories/{0}/".format(id), data=data) | GET /subcategories/:id/
Gets a :format:`subcategory` by ID as ``subcategory``. | 625941b3097d151d1a222c17 |
def scripting_start(self): <NEW_LINE> <INDENT> self.wd = tk.Toplevel(self.root.master) <NEW_LINE> if self.root.octadist_icon is not None: <NEW_LINE> <INDENT> self.wd.wm_iconbitmap(self.root.octadist_icon) <NEW_LINE> <DEDENT> self.wd.title("OctaDist Scripting Interface") <NEW_LINE> self.wd.bind("<Return>", self.script_e... | Start scripting console. | 625941b3b5575c28eb68ddb0 |
def _getting_file_path(self) -> tuple: <NEW_LINE> <INDENT> file_list = os.listdir(self.path) <NEW_LINE> file_list = [os.path.join(self.path, i) for i in file_list] <NEW_LINE> file_list = sorted(file_list, key=os.path.getmtime) <NEW_LINE> file_list.reverse() <NEW_LINE> return tuple(file_list) | Получаем все файлы в нужной дерриктории | 625941b36fece00bbac2d4ee |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.